'cause 'cause IN 257 'd 'd MD 11481 'd 'd NNP 2166 'em 'em PRP 586 'em 'em NNP 15 'll 'll MD 13866 'm be VBP 33489 'n 'n NNP 20 'n' 'n' CC 187 're be VBP 32626 's 's POS 111857 's 's PRP 677 's 's NNP 71 's be VBZ 127676 't 't NN 193 'til 'til IN 22 've have VBP 22738 've have VB 778 -losing -losing UNC 1 1069 1069 NNP 17 727 727 NNP 34 ? ? NN 5149 ?-? ?-? JJ 20 ?-?-? ?-?-? JJ 2 ?-actin ?-actin JJ 99 ?-actine ?-actine JJ 1 ?-actinin ?-actinin JJ 18 ?-active ?-active JJ 1 ?-adrenergic ?-adrenergic JJ 9 ?-adrenergic-receptor ?-adrenergic-receptor JJ 1 ?-adrenergicblockade ?-adrenergicblockade JJ 1 ?-adrenoceptor ?-adrenoceptor JJ 6 ?-agarase ?-agarase JJ 1 ?-agonist ?-agonist JJ 1 ?-amino ?-amino JJ 10 ?-aminoadipoyl ?-aminoadipoyl JJ 1 ?-aminobutyric ?-aminobutyric JJ 1 ?-aminoethyl ?-aminoethyl JJ 1 ?-aminoethylether ?-aminoethylether JJ 1 ?-amylase ?-amylase JJ 2 ?-amylase-like ?-amylase-like JJ 1 ?-amyloid ?-amyloid JJ 2 ?-arrestin ?-arrestin JJ 2 ?-barrel ?-barrel JJ 21 ?-barrel-like ?-barrel-like JJ 1 ?-barrels ?-barrels JJ 2 ?-binding ?-binding JJ 3 ?-blockade ?-blockade JJ 4 ?-blocker ?-blocker JJ 15 ?-blockeri ?-blockeri JJ 1 ?-blockers ?-blockers JJ 5 ?-blocking ?-blocking JJ 3 ?-box ?-box JJ 19 ?-branched ?-branched JJ 3 ?-bungarotoxin ?-bungarotoxin JJ 6 ?-carboxyl ?-carboxyl JJ 2 ?-carboxylate ?-carboxylate JJ 1 ?-carotene ?-carotene JJ 3 ?-catenin ?-catenin JJ 123 ?-catenin-mediated ?-catenin-mediated JJ 2 ?-cell ?-cell JJ 22 ?-cell-like ?-cell-like JJ 1 ?-cells ?-cells JJ 51 ?-chain ?-chain JJ 3 ?-chains-? ?-chains-? JJ 1 ?-chemokine ?-chemokine JJ 1 ?-cholestane ?-cholestane JJ 1 ?-chymotrypsin ?-chymotrypsin JJ 1 ?-cleavage ?-cleavage JJ 1 ?-coefficient ?-coefficient JJ 1 ?-configuration ?-configuration JJ 2 ?-counter ?-counter JJ 2 ?-cryptoxanthin ?-cryptoxanthin JJ 2 ?-ct ?-ct JJ 3 ?-cyclodextrin ?-cyclodextrin JJ 2 ?-d ?-d JJ 2 ?-defensins ?-defensins JJ 1 ?-dependent ?-dependent JJ 3 ?-dihydroprogesterone ?-dihydroprogesterone JJ 1 ?-dihydrotestosterone ?-dihydrotestosterone JJ 2 ?-dimethyl ?-dimethyl JJ 3 ?-diol ?-diol JJ 3 ?-distribution ?-distribution JJ 3 ?-dystrobrevin ?-dystrobrevin JJ 2 ?-dystrobrevin-interacting ?-dystrobrevin-interacting JJ 1 ?-elimination ?-elimination JJ 1 ?-endorphin ?-endorphin JJ 15 ?-estradiol ?-estradiol JJ 25 ?-factor ?-factor JJ 2 ?-factor-free ?-factor-free JJ 1 ?-fibrinogen ?-fibrinogen JJ 7 ?-fodrin ?-fodrin JJ 1 ?-fold ?-fold JJ 1 ?-gal ?-gal JJ 16 ?-galactosidase ?-galactosidase JJ 95 ?-galatosidase ?-galatosidase JJ 1 ?-globin ?-globin JJ 16 ?-glucuronidase ?-glucuronidase JJ 12 ?-glucuronide ?-glucuronide JJ 1 ?-glutamyl ?-glutamyl JJ 1 ?-glutamyl-?-amino-? ?-glutamyl-?-amino-? JJ 1 ?-glutamyl-meso-diaminopimelate ?-glutamyl-meso-diaminopimelate JJ 2 ?-glutamylcysteine ?-glutamylcysteine JJ 1 ?-glutamylcysteinylserine ?-glutamylcysteinylserine JJ 1 ?-glycero-phosphate ?-glycero-phosphate JJ 1 ?-glycerol ?-glycerol JJ 2 ?-glycerolphosphate ?-glycerolphosphate JJ 2 ?-glycerophosphate ?-glycerophosphate JJ 10 ?-goat ?-goat JJ 1 ?-grasp ?-grasp JJ 4 ?-gustducin ?-gustducin JJ 19 ?-hairpin ?-hairpin JJ 5 ?-hairpins ?-hairpins JJ 1 ?-helical ?-helical JJ 20 ?-helices ?-helices JJ 11 ?-helix ?-helix JJ 27 ?-hemolysin ?-hemolysin JJ 1 ?-hemolysis ?-hemolysis JJ 8 ?-hemolytic ?-hemolytic JJ 17 ?-human ?-human JJ 1 ?-hydroxy ?-hydroxy JJ 4 ?-hydroxyestrone ?-hydroxyestrone JJ 1 ?-hydroxylase ?-hydroxylase JJ 2 ?-hydroxylation ?-hydroxylation JJ 1 ?-hydroxysteroid ?-hydroxysteroid JJ 6 ?-independent ?-independent JJ 5 ?-induced ?-induced JJ 2 ?-innervation ?-innervation JJ 2 ?-isopropylmalate ?-isopropylmalate JJ 1 ?-isotype ?-isotype JJ 1 ?-ketobutyrate ?-ketobutyrate JJ 3 ?-ketoglutarate ?-ketoglutarate JJ 8 ?-lactam ?-lactam JJ 19 ?-lactamase ?-lactamase JJ 9 ?-lactamases ?-lactamases JJ 9 ?-lactams ?-lactams JJ 2 ?-like ?-like JJ 2 ?-linolenic ?-linolenic JJ 5 ?-mannosidase ?-mannosidase JJ 1 ?-meanders ?-meanders JJ 2 ?-melanocyte ?-melanocyte JJ 1 ?-mercaptoethanol ?-mercaptoethanol JJ 30 ?-methyl ?-methyl JJ 1 ?-mouse ?-mouse JJ 1 ?-neo ?-neo JJ 1 ?-nerve ?-nerve JJ 1 ?-nicotinamide ?-nicotinamide JJ 1 ?-octyl ?-octyl JJ 2 ?-opioid ?-opioid JJ 41 ?-opioid-mediated ?-opioid-mediated JJ 2 ?-opioids ?-opioids JJ 5 ?-oscillation ?-oscillation JJ 1 ?-oscillations ?-oscillations JJ 2 ?-oxidation ?-oxidation JJ 10 ?-p ?-p JJ 1 ?-pc ?-pc JJ 1 ?-phage ?-phage JJ 1 ?-phosphate ?-phosphate JJ 14 ?-phosphates ?-phosphates JJ 1 ?-phosphatidyl ?-phosphatidyl JJ 1 ?-phosphatidylcholine ?-phosphatidylcholine JJ 1 ?-phosphatidylethanolamine ?-phosphatidylethanolamine JJ 1 ?-phosphatidylinositol ?-phosphatidylinositol JJ 2 ?-phosphonate-group ?-phosphonate-group JJ 1 ?-phosphorothioate ?-phosphorothioate JJ 2 ?-progesterone ?-progesterone JJ 1 ?-propeller ?-propeller JJ 1 ?-protein ?-protein JJ 1 ?-proteobacteria ?-proteobacteria JJ 34 ?-proteobacterial ?-proteobacterial JJ 3 ?-proteobacterium ?-proteobacterium JJ 5 ?-rabbit ?-rabbit JJ 1 ?-receptor ?-receptor JJ 1 ?-reduced ?-reduced JJ 1 ?-reductase ?-reductase JJ 3 ?-replacement ?-replacement JJ 1 ?-responsive ?-responsive JJ 1 ?-rich ?-rich JJ 3 ?-sandwich ?-sandwich JJ 3 ?-sandwich-like ?-sandwich-like JJ 1 ?-scintillation ?-scintillation JJ 6 ?-secretase ?-secretase JJ 30 ?-secretase-cleaved ?-secretase-cleaved JJ 1 ?-secretase-mediated ?-secretase-mediated JJ 3 ?-secretase-type ?-secretase-type JJ 2 ?-secretases ?-secretases JJ 1 ?-secretion ?-secretion JJ 1 ?-selection ?-selection JJ 1 ?-sheet ?-sheet JJ 13 ?-sheets ?-sheets JJ 2 ?-signaling ?-signaling JJ 1 ?-site ?-site JJ 3 ?-sitosterol ?-sitosterol JJ 1 ?-smooth ?-smooth JJ 6 ?-specific ?-specific JJ 1 ?-squared ?-squared JJ 2 ?-stimulated ?-stimulated JJ 5 ?-strand ?-strand JJ 4 ?-strand-?-helix ?-strand-?-helix JJ 1 ?-strand-rich ?-strand-rich JJ 3 ?-strands ?-strands JJ 18 ?-structure ?-structure JJ 3 ?-subdivision ?-subdivision JJ 2 ?-subunit ?-subunit JJ 15 ?-subunits ?-subunits JJ 11 ?-synthase ?-synthase JJ 1 ?-synuclein ?-synuclein JJ 32 ?-synuclein-mediated ?-synuclein-mediated JJ 1 ?-thalassemia ?-thalassemia JJ 3 ?-thick ?-thick JJ 1 ?-thio ?-thio JJ 1 ?-thiophosphorylated ?-thiophosphorylated JJ 1 ?-thrombin ?-thrombin JJ 1 ?-thymosin ?-thymosin JJ 2 ?-tocopherol ?-tocopherol JJ 4 ?-toxin ?-toxin JJ 1 ?-transducin ?-transducin JJ 1 ?-trehalose ?-trehalose JJ 1 ?-tubulin ?-tubulin JJ 97 ?-tubulins ?-tubulins JJ 1 ?-turn ?-turn JJ 2 ?-type ?-type JJ 9 ?? ?? NN 80 ??-ct ??-ct JJ 1 ??-dependent ??-dependent JJ 1 ??? ??? NN 1 ???-proteobacterial ???-proteobacterial JJ 1 ????? ????? NN 2 ?????? ?????? NN 1 ??c ??c NN 4 ??ct ??ct NN 4 ??neo ??neo NN 1 ??pgk-neo ??pgk-neo JJ 5 ??tcr ??tcr NN 3 ?a ?a NN 9 ?a-crystallin ?a-crystallin JJ 1 ?aaand ?aaand NN 1 ?abc ?abc NN 1 ?acbetween ?acbetween NN 1 ?acrybp ?acrybp NN 2 ?actin ?actin NN 1 ?ade ?ade NN 5 ?age ?age NN 1 ?ailing ?ailing VBG 1 ?amboyant ?amboyant NN 1 ?amenco ?amenco NN 1 ?amingos ?amingos NNS 1 ?amp ?amp NN 1 ?ancé ?ancé NN 3 ?and ?and NN 1 ?anking ?anking VBG 1 ?apek ?apek NN 2 ?ar ?ar NN 2 ?ashcards ?ashcards NNS 1 ?at ?at NN 2 ?atoms ?atoms NNS 1 ?atter ?atter NN 1 ?b ?b NN 22 ?b-like ?b-like JJ 3 ?b? ?b? NN 2 ?bers ?bers NNS 2 ?bgt ?bgt NN 2 ?c ?c NN 20 ?can ?can NN 1 ?cat ?cat NN 1 ?cbf ?cbf NN 11 ?ccfor ?ccfor NN 1 ?cells ?cells NNS 1 ?chain ?chain NN 1 ?ci ?ci NN 49 ?crd ?crd NN 2 ?ct ?ct NN 8 ?ction ?ction UNC 1 ?ctional ?ctional NN 1 ?d ?d NN 3 ?dbf ?dbf NN 1 ?dere ?dere NN 1 ?dg ?dg NN 2 ?dht ?dht NN 1 ?di ?di NN 2 ?e ?e NN 21 ?ea-market ?ea-market JJ 2 ?ed ?ed JJ 2 ?edrr ?edrr NN 2 ?eld ?eld NN 5 ?elding ?elding VBG 2 ?elds ?elds NNS 1 ?erko ?erko NN 7 ?ew ?ew NN 2 ?exible ?exible JJ 5 ?exibly ?exibly UNC 1 ?extime ?extime NN 1 ?f ?f NN 35 ?farads ?farads NNS 1 ?fteen ?fteen NN 1 ?g ?g NN 1680 ?g-?h ?g-?h JJ 1 ?gdna ?gdna NN 1 ?geo ?geo NN 2 ?ghting ?ghting VBG 1 ?ghts ?ghts NNS 1 ?glucan ?glucan NN 1 ?gs ?gs NNS 1 ?gt ?gt NN 4 ?gure ?gure NN 5 ?gureheads ?gureheads NNS 1 ?gures ?gures NNS 7 ?h ?h NN 4 ?i ?i NN 7 ?in ?in NN 1 ?ir ?ir NN 5 ?itted ?itted JJ 1 ?j ?j NN 10 ?ja ?ja NN 8 ?k ?k NN 2 ?l ?l NN 1369 ?lac ?lac NN 1 ?lacz ?lacz NN 5 ?lc ?lc NN 1 ?lh ?lh NN 14 ?ll ?ll NN 3 ?llb? ?llb? NN 1 ?lled ?lled JJ 6 ?lling ?lling VBG 2 ?lls ?lls NNS 1 ?log ?log NN 1 ?loxpneo ?loxpneo NN 5 ?loxpneo-tk ?loxpneo-tk JJ 1 ?lrr ?lrr NN 2 ?lter ?lter NN 1 ?lw ?lw NN 10 ?lz ?lz NN 5 ?m ?m NN 1407 ?m-filtered ?m-filtered JJ 1 ?m-thick ?m-thick JJ 1 ?mhc ?mhc NN 4 ?mhc-lacz ?mhc-lacz JJ 2 ?mhclacz ?mhclacz NN 2 ?mol ?mol NN 40 ?mole ?mole NN 4 ?moles ?moles NNS 2 ?most ?most NN 1 ?mtv-ir-cat ?mtv-ir-cat JJ 2 ?n ?n NN 52 ?n-de-siècle ?n-de-siècle JJ 1 ?n-snip ?n-snip JJ 1 ?nal ?nal NN 5 ?nally ?nally RB 10 ?nancial ?nancial NN 4 ?nancially ?nancially RB 2 ?nd ?nd NN 44 ?nding ?nding VBG 7 ?ndings ?ndings NNS 13 ?nds ?nds NNS 2 ?ne ?ne NN 15 ?ne-tuned ?ne-tuned JJ 1 ?nest ?nest NN 10 ?nger ?nger NN 2 ?nish ?nish NN 3 ?nished ?nished JJ 4 ?nishing ?nishing VBG 2 ?nls-far ?nls-far JJ 1 ?od ?od NN 1 ?ogg ?ogg NN 2 ?ood ?ood NN 1 ?oodlit ?oodlit NN 1 ?oor ?oor NN 4 ?oorshows ?oorshows NNS 1 ?or ?or NN 2 ?orf ?orf NN 1 ?oundering ?oundering VBG 1 ?ourish ?ourish NN 1 ?ourished ?ourished JJ 2 ?ourishes ?ourishes NNS 2 ?ow ?ow NN 1 ?owers ?owers NNS 2 ?ows ?ows NNS 1 ?p ?p NN 4 ?pd ?pd NN 2 ?pgk ?pgk NN 1 ?pk ?pk NN 2 ?pop ?pop NN 4 ?pre ?pre NN 18 ?pv ?pv NN 1 ?q ?q NN 1 ?r ?r NN 3 ?rare ?rare NN 3 ?rare-tk-luc ?rare-tk-luc JJ 1 ?re ?re NN 3 ?ring ?ring NN 1 ?ringwas ?ringwas NNS 1 ?rm ?rm NN 9 ?rmly ?rmly RB 4 ?rmness ?rmness NNS 1 ?routine ?routine NN 2 ?rst ?rst NN 78 ?rst-borns ?rst-borns JJ 1 ?rst-class ?rst-class JJ 2 ?rst-grade ?rst-grade JJ 1 ?rst-time ?rst-time JJ 1 ?rstborn ?rstborn NN 1 ?rsthand ?rsthand NN 1 ?s ?s NNS 13 ?s ?s NN 2 ?s? ?s? NN 2 ?sec ?sec NN 3 ?self-preservation-minded ?self-preservation-minded JJ 1 ?sh ?sh NN 4 ?shermen ?shermen NN 1 ?shes ?shes NNS 1 ?shing ?shing VBG 3 ?sini-?pwäwa ?sini-?pwäwa JJ 1 ?sland ?sland NN 1 ?slt ?slt NN 1 ?t ?t NN 12 ?tpr ?tpr NN 1 ?tpr-pfpp ?tpr-pfpp JJ 7 ?trcp ?trcp NN 1 ?triplex ?triplex NN 3 ?ts ?ts NNS 2 ?u ?u NN 4 ?uctuated ?uctuated JJ 1 ?v ?v NN 1 ?v? ?v? NN 7 ?ve ?ve NN 2 ?x ?x NN 1 ?xed ?xed JJ 2 ?xing ?xing VBG 1 ?xj ?xj NN 2 ?y ?y NN 5 ?ying ?ying VBG 1 ?yj ?yj NN 4 ?yover ?yover NN 2 ?í?o? ?í?o? NN 1 a a DT 490433 a a UNC 1048 a a NNP 847 a a NN 237 a a SYM 97 a a JJ 7 a-a a-a JJ 2 a-a a-a NNP 1 a-a-c a-a-c NNP 9 a-abaker a-abaker JJ 1 a-adrenoceptor a-adrenoceptor JJ 1 a-alternate a-alternate JJ 1 a-ank-fgf a-ank-fgf NNP 1 a-atp a-atp NNP 24 a-b a-b NNP 16 a-b-b-bye-bye a-b-b-bye-bye JJ 1 a-b-c a-b-c NNP 5 a-b-c-d a-b-c-d NNP 1 a-b-x-y a-b-x-y NNP 1 a-babble a-babble JJ 1 a-barrel a-barrel JJ 1 a-bed a-bed JJ 1 a-bigger a-bigger JJ 1 a-brewin a-brewin JJ 2 a-brewing a-brewing JJ 1 a-bustin a-bustin JJ 1 a-c a-c NNP 19 a-c a-c JJ 2 a-c-c a-c-c NNP 9 a-c-p a-c-p NNP 5 a-c-t a-c-t NNP 1 a-c-t-h a-c-t-h NNP 7 a-callin a-callin JJ 1 a-calling a-calling JJ 1 a-cand a-cand JJ 1 a-cappella a-cappella JJ 1 a-changin a-changin JJ 1 a-child a-child JJ 2 a-cockbill a-cockbill JJ 1 a-comin a-comin JJ 1 a-cut a-cut JJ 1 a-d a-d NNP 10 a-d a-d JJ 6 a-d-d a-d-d NNP 1 a-d-h a-d-h NNP 1 a-d-p a-d-p NNP 8 a-day a-day JJ 2 a-derived a-derived JJ 2 a-diaza-s-indacine a-diaza-s-indacine JJ 1 a-dna a-dna NNP 3 a-duplicate a-duplicate JJ 1 a-e a-e NNP 5 a-f a-f NNP 6 a-f-s a-f NNP 1 a-factor a-factor JJ 1 a-feared a-feared JJ 1 a-flutter a-flutter JJ 1 a-g a-g NNP 5 a-general a-general NNP 1 a-glimmering a-glimmering JJ 1 a-gonna a-gonna JJ 2 a-got a-got JJ 1 a-gvhd a-gvhd NNP 53 a-h a-h NNP 7 a-h a-h JJ 3 a-ha a-ha JJ 2 a-hehm a-hehm JJ 1 a-hem a-hem NNP 1 a-hem a-hem JJ 1 a-ho a-ho JJ 1 a-hp a-hp JJ 1 a-i a-i JJ 2 a-i a-us NNP 1 a-join-ed a-join-ed JJ 1 a-k a-k NNP 1 a-kan a-kan JJ 1 a-l a-l NNP 5 a-l-b a-l-b NNP 1 a-l-s a-l NNP 1 a-leaping a-leaping JJ 1 a-line a-line JJ 2 a-list a-list JJ 3 a-loo-min-um-foil a-loo-min-um-foil JJ 1 a-love a-love JJ 1 a-lovin a-lovin JJ 1 a-lu-min-i-um a-lu-min-i-um JJ 1 a-lying a-lying JJ 1 a-m a-m NNP 12 a-m-a a-m-a NNP 1 a-mazing a-mazing JJ 1 a-me a-me JJ 1 a-million-to-one a-million-to-one JJ 1 a-minus a-minus NNP 1 a-month a-month JJ 4 a-month-for-domestic-help a-month-for-domestic-help JJ 1 a-more a-more JJ 1 a-myc a-myc JJ 6 a-n a-n NNP 4 a-n a-n JJ 2 a-n-a a-n-a NNP 1 a-n-p a-n-p NNP 1 a-night a-night JJ 5 a-not a-not JJ 2 a-nt a-nt NNP 2 a-ny a-ny NNP 106 a-ok a-ok NNP 8 a-p a-p NNP 35 a-p-a a-p-a NNP 3 a-person a-person JJ 2 a-phorbol a-phorbol JJ 2 a-pinin a-pinin JJ 1 a-plate a-plate JJ 5 a-plinkin a-plinkin JJ 1 a-r a-r NNP 5 a-r-b-d a-r-b-d NNP 1 a-r-i a-r-us NNP 2 a-rattling a-rattling JJ 1 a-really-bad-cold-where-you-say-it a-really-bad-cold-where-you-say-it JJ 1 a-religiousness a-religiousness JJ 1 a-rockin a-rockin JJ 1 a-rod-style a-rod-style NNP 1 a-rollin a-rollin JJ 1 a-s a NNP 17 a-s-d a-s-d NNP 2 a-s-i-m-o-v a-s-i-m-o-v NNP 1 a-share a-share JJ 1 a-side a-side JJ 4 a-side a-side NNP 1 a-swabbin a-swabbin JJ 1 a-t a-t NNP 8 a-t-p a-t-p NNP 45 a-team a-team NNP 1 a-ticking a-ticking JJ 1 a-titter a-titter JJ 1 a-turning a-turning JJ 1 a-typical a-typical JJ 1 a-u a-u JJ 1 a-u a-u NNP 1 a-v a-v NNP 1 a-w a-w NNP 1 a-wailing a-wailing JJ 1 a-way a-way JJ 1 a-week a-week JJ 2 a-well a-well JJ 1 a-workin a-workin JJ 1 a-wt a-wt NNP 1 a-y a-y NNP 4 a-yard a-yard JJ 1 a-yeah a-yeah JJ 1 a-year a-year JJ 11 a-yup a-yup JJ 1 a-z a-z NNP 14 a-z-t a-z-t NNP 3 a? a? NNP 23 a?eld a?eld NN 1 aa aa NN 382 aa aa NNP 60 aa-amino aa-amino NNP 1 aa-binding aa-binding NNP 6 aa-d aa-d JJ 3 aa-enriched aa-enriched NNP 1 aa-raxpé-ahu aa-raxpé-ahu JJ 1 aa-rich aa-rich NNP 1 aa-tttt aa-tttt NNP 2 aaa aaa NNP 187 aaa-domain aaa-domain NNP 3 aaaa aaaa NNP 2 aaaaa aaaaa NNP 1 aaaaa aaaaa NN 1 aaaaaa aaaaaa NNP 3 aaaaaaa aaaaaaa NNP 1 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa NNP 1 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaah aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaah NNP 1 aaaaaaaaaaare aaaaaaaaaaare NN 1 aaaaaaaagh aaaaaaaagh NNP 1 aaaaaaaahahahahahahaha aaaaaaaahahahahahahaha NNP 1 aaaaaaaccent aaaaaaaccent NN 2 aaaaaaadddaaammmmmm aaaaaaadddaaammmmmm NNP 1 aaaaaaagh aaaaaaagh NNP 1 aaaaaaahh aaaaaaahh NNP 1 aaaaaaand aaaaaaand NN 1 aaaaaagh aaaaaagh NNP 2 aaaaaah aaaaaah NN 2 aaaaaah aaaaaah NNP 1 aaaaaahhh aaaaaahhh NNP 1 aaaaaannnnnd aaaaaannnnnd NNP 1 aaaaaarrrrrgh aaaaaarrrrrgh NNP 1 aaaaaggghhh aaaaaggghhh NNP 1 aaaaaghhh aaaaaghhh NNP 1 aaaaahhh aaaaahhh NNP 1 aaaaahhhhhh aaaaahhhhhh NNP 1 aaaaand aaaaand NNP 1 aaaaargh aaaaargh NNP 1 aaaaauuughhh aaaaauuughhh NNP 1 aaaaaw aaaaaw NNP 1 aaaacacaacgaaacctg aaaacacaacgaaacctg NNP 1 aaaaccccaaaa aaaaccccaaaa NNP 1 aaaach aaaach NNP 1 aaaack aaaack NNP 1 aaaactgcagcggccgccaccatgcaccac-caccacaccaccaccacgtgagcaagggcgaggagctgttcaccg aaaactgcagcggccgccaccatgcaccac-caccacaccaccaccacgtgagcaagggcgaggagctgttcaccg NNP 1 aaaagaaaaaa aaaagaaaaaa NNP 1 aaaagataaag aaaagataaag NNP 1 aaaagcggccgcgagtggggggcggcggcc aaaagcggccgcgagtggggggcggcggcc NNP 1 aaaagcttcttgaaaggagacttctgt aaaagcttcttgaaaggagacttctgt NNP 1 aaaaggtgggcctgaggttca aaaaggtgggcctgaggttca NNP 1 aaaagh aaaagh NNP 2 aaaagh aaaagh NN 1 aaaagtcgacgcgcccagcagcgagaccgc aaaagtcgacgcgcccagcagcgagaccgc NNP 1 aaaah aaaah NNP 3 aaaahh aaaahh NNP 1 aaaahhh aaaahhh NNP 1 aaaan-ist aaaan-ist NNP 2 aaaand aaaand NNP 2 aaaargghhh aaaargghhh NNP 1 aaaargh aaaargh NNP 1 aaaargh aaaargh NN 1 aaaarrgh aaaarrgh NN 1 aaaarrrrrggghhhhh aaaarrrrrggghhhhh NNP 1 aaaawwww aaaawwww NNP 1 aaaawwwwww aaaawwwwww NNP 1 aaab aaab NNP 2 aaabs aaab NNP 1 aaacaggattttcgcctgctggg aaacaggattttcgcctgctggg NNP 2 aaaccatctcactcgcatga aaaccatctcactcgcatga NNP 1 aaaccent aaaccent NN 1 aaacgacggccagtgaattgtaatacgactcactataggcgc aaacgacggccagtgaattgtaatacgactcactataggcgc NNP 1 aaacgacggccagtgaattgtaatacgactcactataggg aaacgacggccagtgaattgtaatacgactcactataggg NNP 1 aaactgtacttgttatcaggat aaactgtacttgttatcaggat NNP 1 aaactgtgg aaactgtgg NNP 1 aaag aaag NNP 1 aaaggaccccacgaagtgtt aaaggaccccacgaagtgtt NNP 1 aaagh aaagh NNP 2 aaah aaah NNP 1 aaah aaah NN 1 aaahh aaahh NNP 1 aaahhhh aaahhhh NNP 1 aaahing aaah VBG 1 aaaieeeooh aaaieeeooh NNP 1 aaaieeeoooh aaaieeeoooh NNP 1 aaaiiggghhh aaaiiggghhh NNP 1 aaaiiiieeeee aaaiiiieeeee NNP 1 aaalac aaalac NNP 1 aaand aaand NN 1 aaand aaand NNP 1 aaargh aaargh NNP 9 aaarrgghhh aaarrgghhh NNP 1 aaarrgh aaarrgh NNP 1 aaarrrggghhh aaarrrggghhh NNP 1 aaarrrrrgggggghhhhh aaarrrrrgggggghhhhh NN 1 aaat aaat NNP 2 aaataaat aaataaat NNP 1 aaatctcaat aaatctcaat NNP 1 aaatgcagttgttactgtccctg aaatgcagttgttactgtccctg NNP 1 aaatgcatctgcgagggc aaatgcatctgcgagggc NNP 1 aaawwwww aaawwwww NNP 1 aab aab NNP 2 aab aab NN 1 aabb aabb NNP 5 aabb aabb NN 2 aac aac NNP 41 aac aac NN 1 aaca aaca NNP 4 aacacagtgagacgctgtct aacacagtgagacgctgtct NNP 1 aacc aacc NN 3 aaccaa aaccaa NNP 1 aaccatgcaggtacagtc aaccatgcaggtacagtc NNP 1 aacccacatgttcacggcgga aacccacatgttcacggcgga NNP 1 aacctcctct aacctcctct NNP 1 aacctctccattcagc aacctctccattcagc NNP 1 aacgggaagcccatcacc aacgggaagcccatcacc NNP 1 aachen aachen NNP 7 aack aack NNP 1 aactagatgtagaagtcgttcatggattc aactagatgtagaagtcgttcatggattc NNP 1 aad aad NNP 13 aadntp aadntp NN 1 aadutp aadutp NN 2 aae aa NNP 1 aaf aaf NNP 5 aafp aafp NN 1 aag aag NNP 15 aag-gtggtaaaccagggggatc aag-gtggtaaaccagggggatc NNP 1 aagaattcaaactggggcct aagaattcaaactggggcct NNP 1 aagagtagctgctcaccgtgtacaag aagagtagctgctcaccgtgtacaag NN 1 aagcagtggtaacaacgc aagcagtggtaacaacgc NNP 1 aagcagtggtaacaacgcagagtacgcggg aagcagtggtaacaacgcagagtacgcggg NNP 1 aagcagtggtatcaacgcagagtacgcggg aagcagtggtatcaacgcagagtacgcggg NNP 1 aagccctctgaacagtgtcccatcccaagt aagccctctgaacagtgtcccatcccaagt NNP 1 aagccgggaaggatctgtat aagccgggaaggatctgtat NNP 1 aagcctgaccacgctttcta aagcctgaccacgctttcta NNP 1 aagctt aagctt NNP 1 aagg aagg NNP 1 aaggagtgcggggaggag aaggagtgcggggaggag NNP 1 aaggghhh aaggghhh NNP 1 aaggtcaaaattcaacagctgcttgtacagctcgtccatgcc aaggtcaaaattcaacagctgcttgtacagctcgtccatgcc NNP 1 aaggtcaaaattcaacagctgggtgggtgctaatcctaatggttc aaggtcaaaattcaacagctgggtgggtgctaatcctaatggttc NNP 1 aaggtgcggagcaaaat aaggtgcggagcaaaat NNP 1 aagh aagh NN 1 aah aah NNP 4 aah aah NN 3 aahed aahed JJ 5 aahh aahh NN 1 aahing aah VBG 2 aahp aahp NNP 14 aahs aah NNS 2 aaib aaib NNP 1 aaiii aaiius NNP 2 aair aair NN 3 aairs aair NNS 1 aak aak NNP 2 aake aake NN 1 aakp aakp NNP 1 aakp aakp NN 1 aal aal NNP 58 aal-american aal-american NNP 1 aala aalum NNP 1 aalborg aalborg NNP 1 aalikum aalikum NN 1 aaliyah aaliyah NNP 4 aalso aalso NN 1 aalto aalto NNP 5 aam aam NNP 2 aamco aamco NNP 1 aames aame NNP 1 aand aand NNP 118 aand aand NN 32 aap aap NNP 10 aap aap NN 2 aapf-p-nitroanilide aapf-p-nitroanilide NNP 1 aapf-pna aapf-pna NNP 3 aapfakkk aapfakkk NNP 1 aaps aap NNP 3 aard aard NN 1 aardvark aardvark NNP 2 aardvark aardvark NN 2 aardvarken aardvarken NN 1 aardvarks aardvark NNP 1 aare aare NNP 2 aarg aarg NNP 1 aargh aargh NNP 10 aarikkaa aarikkaa NNP 1 aaron aaron NNP 175 aaron aaron NN 3 aaronetta aaronetta NNP 2 aaronic aaronic NNP 1 aaronj aaronj NNP 1 aaronson aaronson NNP 4 aarp aarp NNP 44 aarp aarp NN 2 aarp aarp UNC 1 aarparific aarparific NNP 1 aarrrrrggghhhh aarrrrrggghhhh NNP 1 aars aar NN 4 aarss aarss NNS 4 aas aa NNP 4 aas aa NNS 2 aasa aasa NNP 1 aasland aasland NNP 3 aassumes aassume NNS 1 aat aat NNP 28 aat aat NN 2 aataaa aataaa NNP 1 aataacctccaaattgacctg aataacctccaaattgacctg NNP 1 aatctgcagctatgaaatccc aatctgcagctatgaaatccc NNP 1 aatctttcatagttcatgcgtt aatctttcatagttcatgcgtt NNP 1 aatgaagcggagttcccaaagc aatgaagcggagttcccaaagc NNP 1 aatgaccaattatatgaatcaattatctg aatgaccaattatatgaatcaattatctg NNP 1 aatgggcagaggtataaagataagga aatgggcagaggtataaagataagga NNP 1 aattaaaccatccaatgaaatagagc aattaaaccatccaatgaaatagagc NNP 1 aattcagtgaactggccacc aattcagtgaactggccacc NNP 1 aattcatgctatgatgatgatgatgatggctac aattcatgctatgatgatgatgatgatggctac NNP 1 aattctgacaatcgacgccag aattctgacaatcgacgccag NNP 1 aattctggagcttctggatccaagaatggaatcaaagttaag aattctggagcttctggatccaagaatggaatcaaagttaag NNP 1 aatttatatggaatgctacgatt aatttatatggaatgctacgatt NNP 1 aau aau NNP 3 aauaaa aauaaa NNP 2 aaucmb aaucmb NNP 3 aaup aaup NNP 4 aava aava NNP 2 aave aave NNP 4 aaw aaw NNP 2 aawww aawww NNP 1 ab ab NNP 210 ab ab NN 42 ab ab UNC 1 ab-boin-ug ab-boin-ug JJ 1 ab-dependent ab-dependent NNP 1 ab-initio ab-initio JJ 1 aba aba NNP 56 aba aba NN 2 aba aba UNC 1 aba-mediated aba-mediated NNP 1 aba-nlada aba-nlada NNP 1 aba-response aba-response NNP 1 abaa abaa NN 1 ababa ababa NNP 1 ababb ababb NN 1 abac abac NN 1 abacavir abacavir NN 4 abacha abacha NNP 11 aback aback RB 26 abaco abaco NNP 9 abaconians abaconian NNP 1 abacos abaco NNP 10 abacus abacus JJ 8 abacus abacus NNP 3 abacuses abacus NNS 1 abacuses abacus NNP 1 abad abad NNP 3 abad abad NN 1 abade abade NNP 1 abadie abadie NNP 1 abado abado NNP 1 abaft abaft NN 1 abagyan abagyan NNP 3 abajo abajo NNP 2 abalon abalon NNP 1 abalone abalone NN 10 abalone abalone NNP 1 aban aban NN 1 abandandoned abandandoned JJ 1 abandon abandon VB 218 abandon abandon VBP 11 abandon abandon NNP 5 abandoned abandon VBN 351 abandoned abandon VBD 129 abandoned abandoned NNP 7 abandoned abandoned UNC 5 abandoned abandoned JJ 2 abandoned-including abandoned-including JJ 1 abandoner abandoner NN 1 abandonimg abandonimg NN 1 abandoning abandon VBG 115 abandoning abandoning UNC 1 abandonment abandonment NN 46 abandonment abandonment NNP 2 abandons abandon VBZ 13 abandons abandon NNP 3 abang abang NNP 8 abangales abangale NNP 1 abanic abanic NNP 1 abanus abanus NNP 1 abarca abarca NNP 1 abarcas abarca NNP 2 abarinov abarinov NNP 1 abarnard abarnard NN 1 abas aba NNP 1 abase abase NN 1 abashed abashed JJ 10 abashment abashment NN 1 abasic abasic JJ 18 abasic abasic NNP 1 abate abate VB 11 abate abate NNP 7 abated abate VBN 16 abatement abatement NN 8 abatement abatement NNP 2 abating abate VBG 7 abattoir abattoir NN 3 abattoir abattoir NNP 1 abaxial abaxial NN 1 abb abb NNP 17 abba abba NNP 6 abbaddaba abbaddaba NNP 1 abbado abbado NNP 2 abbas abba NNP 7 abbasid abbasid NNP 1 abbasiya abbasiya NNP 2 abbass abbass NNP 2 abbate abbate NNP 5 abbatiale abbatiale NNP 2 abbaye abbaye NNP 4 abbayedefontenay abbayedefontenay NN 1 abbayes abbay NNP 1 abbdominal abbdominal NN 1 abbe abbe NNP 4 abbella abbellum NN 1 abberation abberation NN 1 abbess abbess NNS 2 abbesses abbess NNP 3 abbeville abbeville NNP 2 abbey abbey NNP 88 abbey abbey NN 41 abbeys abbey NNS 6 abbeys abbey NNP 1 abbie abbie NNP 9 abbondanza abbondanza NNP 2 abbot abbot NNP 27 abbot abbot NN 16 abbots abbot NNS 2 abbott abbott NNP 57 abbotts abbott NNP 4 abboud abboud NNP 4 abboy abboy NNP 1 abbr abbr NNP 2 abbreivations abbreivation NNP 1 abbrev abbrev NNP 6 abbreviate abbreviate NN 10 abbreviate abbreviate NNP 2 abbreviated abbreviated JJ 59 abbreviated abbreviated NNP 1 abbreviates abbreviate NNS 1 abbreviating abbreviate VBG 4 abbreviation abbreviation NN 52 abbreviation abbreviation NNP 2 abbreviation abbreviation JJ 1 abbreviations abbreviation NNP 191 abbreviations abbreviation NNS 111 abbreviaturis abbreviaturi NNP 1 abbreviatus abbreviatus JJ 1 abbrevs abbrev NNP 1 abbuehl abbuehl NNP 1 abby abby NNP 75 abc abc NNP 679 abc abc NN 4 abc abc UNC 2 abc-dab abc-dab NNP 1 abc-horseradish abc-horseradish NNP 1 abc-hrp abc-hrp NNP 1 abc-kit abc-kit NNP 1 abc-paramount abc-paramount NNP 1 abc-tv abc-tv NNP 7 abca abca NNP 7 abcb abcb NNP 2 abcd abcd NNP 6 abcdefghijklmnopqrstuvwxyz abcdefghijklmnopqrstuvwxyz NNP 1 abce abce NNP 3 abcfamily abcfamily NNP 1 abcg abcg NNP 86 abcissa abcissa NN 1 abcnews abcnew NNP 4 abcnews abcnew NNS 3 abcs abc NNP 10 abcs abcs UNC 1 abd abd NNP 18 abd abd NN 2 abd-er abd-er NNP 3 abdalla abdallum NNP 6 abdallah abdallah NNP 10 abdalrahman abdalrahman NNP 1 abdel abdel NNP 47 abdelamir abdelamir NNP 1 abdelaziz abdelaziz NNP 2 abdelbari abdelbarus NNP 3 abdelghani abdelghanus NNP 14 abdeljaber abdeljaber NNP 12 abdelkader abdelkader NNP 1 abdellatif abdellatif NNP 1 abdelmajed abdelmajed NNP 1 abdelwahhab abdelwahhab NNP 1 abdera abdera NNP 1 abderrahman abderrahman NNP 2 abderraman abderraman NNP 1 abderraouf abderraouf NNP 4 abdessalem abdessalem NNP 2 abdf abdf NNP 3 abdi abdus NN 8 abdi abdus NNP 6 abdia abdium NNP 2 abdicate abdicate VBP 10 abdicated abdicated JJ 11 abdicating abdicate VBG 3 abdication abdication NN 20 abdication abdication NNP 1 abdications abdication NNS 1 abdil abdil NNP 2 abdnr abdnr NNP 1 abdnu abdnu NNP 1 abdoh abdoh NNP 4 abdolghassem abdolghassem NNP 3 abdomen abdomen NN 38 abdomen-crush abdomen-crush JJ 1 abdomens abdomen NNS 2 abdominal abdominal NN 120 abdominal abdominal NNP 4 abdominals abdominal NNS 4 abdominis abdomini NNS 2 abdoulaye abdoulaye NNP 1 abdoun abdoun NNP 3 abducens abducen NNP 3 abducens abducen NNS 2 abduct abduct NN 5 abducted abducted NN 49 abducted abducted NNP 1 abductee abductee NN 1 abductees abductee NNS 2 abducting abduct VBG 4 abduction abduction NN 38 abduction abduction NNP 3 abduction-molestation-murder abduction-molestation-murder JJ 1 abductions abduction NNS 43 abductions abduction NNP 2 abductor abductor NN 4 abductors abductor NNS 2 abducts abduct NNS 1 abdul abdul NNP 102 abdulaziz abdulaziz NNP 3 abdulla abdullum NNP 3 abdullah abdullah NNP 208 abdullah-recalled abdullah-recalled NNP 1 abdulmuttaleb abdulmuttaleb NNP 1 abdulrab abdulrab NNP 1 abdulsalam abdulsalam NNP 2 abdur abdur NNP 1 abdurraham abdurraham NNP 1 abdurrahman abdurrahman NNP 7 abdál abdál NN 1 abdül abdül NNP 8 abe abe NNP 59 abe abe NN 1 abeam abeam NN 1 abeautiful abeautiful NNP 1 abebe abebe NNP 1 abecedarium abecedarium NNP 4 abecedarius abecedarius JJ 2 abed abed NNP 4 abedi abedus NNP 2 abednego abednego NN 2 abednego abednego NNP 2 abeer abeer NNP 2 abel abel NNP 31 abelard abelard NNP 1 abele abele NNP 2 abeline abeline NNP 1 abell abell NNP 1 abelmoschus abelmoschus JJ 1 abelson abelson NNP 20 abelsonprofessor abelsonprofessor NNP 1 abencerrajes abencerraje NNP 2 abend abend NNP 1 abendgarderobe abendgarderobe NNP 3 aberamenthooulerthexanaxethreluoothnemareba aberamenthooulerthexanaxethreluoothnemareba NNP 1 abercombie abercombie NNP 1 abercrombie abercrombie NNP 24 abercrombie abercrombie NN 1 abercromby abercromby NNP 3 aberdeen aberdeen NNP 22 aberdonians aberdonian NNP 1 aberg aberg NNP 1 aberlour aberlour NNP 7 abernathy abernathy NNP 9 aberrancies aberrancy NNS 11 aberrancy aberrancy NN 3 aberrant aberrant NN 106 aberrant aberrant NNP 6 aberrantly aberrantly RB 14 aberration aberration NN 18 aberration aberration NNP 1 aberrational aberrational NN 3 aberrations aberration NNS 27 aberrations aberration NNP 1 abert abert NNP 1 abet abet NN 6 abets abet NNS 1 abetted abet VBN 13 abetted abetted NNP 2 abetted abetted UNC 1 abetter abetter NNP 1 abetting abet VBG 14 abettor abettor NN 1 abeyance abeyance NN 1 abf abf NNP 2 abfab abfab NNP 3 abg abg NNP 1 abgene abgene NNP 3 abh abh NNP 1 abhominable abhominable JJ 1 abhor abhor NN 11 abhorred abhorred JJ 6 abhorred abhorred UNC 1 abhorrence abhorrence NN 4 abhorrent abhorrent NN 7 abhors abhor NNS 10 abhors abhor NNP 1 abi abus NNP 119 abi abus NN 8 abi-prism abi-prism NNP 2 abia abium NNP 1 abiankapas abiankapa NNP 1 abicada abicada NNP 1 abid abid NNP 1 abide abide VB 58 abide-and abide-and JJ 1 abided abided JJ 5 abides abide NNS 2 abidin abidin NNP 1 abiding abide VBG 37 abiding abiding UNC 1 abidjan abidjan NNP 2 abie abie NNP 1 abierto abierto NN 1 abies aby NNS 2 abies aby NNP 1 abig abig NN 2 abigail abigail NNP 36 abigale abigale NNP 1 abil abil NN 1 abilene abilene NNP 38 abilites abilite NNS 1 abilities abilities UNC 2 abilities ability NNS 184 abilities ability NNP 2 ability ability NN 2493 ability ability NNP 9 ability ability UNC 3 ability ability JJ 1 ability-to-make-fire-in-rain ability-to-make-fire-in-rain JJ 1 abilityto abilityto NN 1 abim abim NNP 1 abingdon abingdon NNP 4 abiola abiolum NNP 9 abiotic abiotic JJ 26 abiotic abiotic NNP 1 abiotically abiotically RB 1 abiquiu abiquiu NNP 1 abir abir NNP 7 abir abir NN 1 abirdsworld abirdsworld NNP 1 abisco abisco NNP 1 abish abish NNP 1 abisynth abisynth NN 1 abit abit NN 1 abit abit NNP 1 abita abita NNP 2 abitation abitation NNP 2 abitur abitur NNP 1 abj abj NNP 1 abject abject NN 31 abjected abjected JJ 1 abjection abjection NN 2 abjection abjection UNC 1 abjectly abjectly RB 7 abjectness abjectness UNC 1 abjure abjure NN 5 abjured abjured JJ 1 abjures abjure NNS 2 abjuring abjure VBG 1 abkhazia abkhazium NNP 3 abl abl NNP 30 abl abl NN 2 abladen abladen NN 1 ablaqueate ablaqueate NN 1 ablaqueate ablaqueate NNP 1 ablasion ablasion NN 1 ablata abla NN 1 ablatable ablatable NNP 1 ablate ablate NN 6 ablated ablated JJ 19 ablates ablate NNS 2 ablating ablate VBG 3 ablation ablation NN 66 ablation ablation NNP 5 ablations ablation NNS 2 ablations ablation NNP 1 ablative ablative JJ 5 ablaze ablaze NN 17 ablaze ablaze NNP 1 able able JJ 5660 able able NNP 12 able-bodied able-bodied JJ 12 abled abled JJ 1 ableto ableto NN 2 ablidged ablidged JJ 1 ablities ablity NNS 1 abloom abloom NN 1 abluminal abluminal NN 5 abluted abluted JJ 1 ablution ablution NN 2 ablutions ablutions NNS 7 ably ably RB 13 abm abm NNP 14 abn abn NNP 1 abnaki abnakus NNP 2 abnegation abnegation NN 2 abner abner NNP 22 abnor abnor NN 1 abnormal abnormal JJ 281 abnormal abnormal NNP 10 abnormalities abnormality NNS 231 abnormalities abnormality NNP 5 abnormality abnormality NN 66 abnormally abnormally RB 32 abnormally abnormally NNP 1 abnormals abnormal NNS 1 abnr abnr NNP 2 abo abo NN 6 abo abo JJ 1 aboard aboard IN 201 aboard aboard NNP 4 aboard aboard RB 3 aboc aboc NNP 1 abode abode NN 10 abode abode NNP 1 abodes abode NNS 1 abodiement abodiement NN 1 abogadillo abogadillo NN 1 abogado abogado NN 1 abol abol NN 1 abolish abolish VB 65 abolish abolish NNP 4 abolished abolish VBN 68 abolished abolish VBD 56 abolished abolished UNC 1 abolished abolished NNP 1 abolishes abolish NNS 11 abolishing abolish VBG 40 abolishing abolishing NNP 1 abolition abolition NN 49 abolition abolition NNP 2 abolition abolition UNC 1 abolition-of-function abolition-of-function JJ 1 abolitionism abolitionism NN 2 abolitionist abolitionist NN 13 abolitionists abolitionist NNS 10 abolitionists abolitionist NNP 1 abomelic abomelic NNP 1 abominable abominable JJ 12 abominably abominably RB 2 abominated abominated JJ 1 abomination abomination NN 21 abomination abomination NNP 3 abomination abomination UNC 1 abominations abomination NNS 5 abominationvegetable abominationvegetable JJ 1 abominosus abominosus JJ 1 abonuses abonus NNS 1 aboot aboot NN 1 abootty abootty NNP 2 abooty abooty NNP 1 abor abor NN 1 aboriginal aboriginal NNP 49 aboriginal aboriginal NN 12 aborigine aborigine NNP 4 aborigine aborigine NN 1 aborigines aborigine NNP 24 aborigines aborigine NNS 5 aborigines aborigines UNC 1 aborigén aborigén NNP 1 abort abort NN 15 abort abort NNP 2 aborted abort VBN 2 aborted aborted JJ 25 aborted aborted UNC 1 abortifacent abortifacent NN 1 abortifacents abortifacent NNS 1 abortifacient abortifacient NN 2 aborting abort VBG 6 aborting aborting NNP 1 abortion abortion NN 651 abortion abortion NNP 26 abortion abortion UNC 9 abortion abortion JJ 1 abortion-abetting abortion-abetting JJ 1 abortion-clinic abortion-clinic JJ 2 abortion-clinic abortion-clinic NNP 1 abortion-free abortion-free JJ 1 abortion-neutral abortion-neutral JJ 1 abortion-related abortion-related JJ 5 abortion-reporting abortion-reporting JJ 1 abortion-rights abortion-right NNS 17 abortionist abortionist NN 4 abortionists abortionist NNS 2 abortionists abortionist NNP 2 abortions abortion NNS 146 abortions abortion NNP 4 abortions abortions UNC 7 abortions abortions JJ 1 abortive abortive JJ 30 abortive abortive NNP 1 aborto aborto NN 1 aborts abort NNS 1 abortus abortus JJ 35 abortuses abortus NNS 1 abortusvaccine abortusvaccine NN 1 aborville aborville NNP 1 abot abot NN 2 abotu abotu NN 3 abou abou NNP 4 abou abou NN 3 abouhalima abouhalima NNP 4 aboukir aboukir NNP 1 abound abound VBP 96 abound abound NNP 4 abounded abound VBD 9 aboundeth aboundeth NN 1 abounding abound VBG 1 abounds abound VBZ 24 abounds abound NNP 1 about about IN 58578 about about RB 243 about about RP 185 about about JJ 111 about about UNC 104 about about NNP 89 about-face about-face NN 18 about-to-be about-to-be JJ 2 about-to-be-announced about-to-be-announced JJ 2 about-to-be-born about-to-be-born JJ 2 about-to-be-created about-to-be-created JJ 1 about-to-be-published about-to-be-published JJ 2 about-to-be-released about-to-be-released JJ 1 about-to-be-resuscitated about-to-be-resuscitated JJ 1 about-town about-town JJ 1 abouts about NNS 6 aboutthem aboutthem NN 1 abouttheportauthority abouttheportauthority NNP 1 above above IN 3494 above above JJ 400 above above RB 23 above above UNC 13 above above NNP 6 above-average above-average JJ 9 above-defined above-defined JJ 1 above-described above-described JJ 4 above-detected above-detected JJ 1 above-discussed above-discussed JJ 1 above-ground above-ground JJ 5 above-has above-ha JJ 1 above-hurdle above-hurdle JJ 1 above-it-all above-it-all JJ 2 above-listed above-listed JJ 2 above-market above-market JJ 1 above-mentioned above-mentioned JJ 16 above-named above-named JJ 1 above-noted above-noted JJ 1 above-politics above-politic JJ 1 above-the-eyebrow above-the-eyebrow JJ 1 above-the-fold above-the-fold JJ 25 above-the-fold above-the-fold NNP 1 above-the-fray above-the-fray JJ 2 above-the-knee above-the-knee JJ 2 above-the-title above-the-title JJ 1 above-threshold above-threshold JJ 2 aboveboard aboveboard NN 4 aboveboard aboveboard NNP 1 abovedescribed abovedescribed JJ 1 aboveground aboveground NN 2 abovementioned abovementioned JJ 1 abox abox NN 1 abp abp NNP 35 abp-containing abp-containing NNP 1 abp-tg abp-tg NNP 37 abpnn abpnn NN 1 abr abr NNP 1 abra abra NNP 13 abracadabra abracadabra NN 2 abracadabra abracadabra NNP 1 abrading abrade VBG 1 abraham abraham NNP 138 abrahamowicz abrahamowicz NNP 1 abrahams abraham NNP 5 abrahamsen abrahamsen NNP 1 abrahms abrahm NNP 1 abrain abrain NN 1 abram abram NNP 1 abramovic abramovic NNP 1 abramovich abramovich NNP 1 abramovitz abramovitz NNP 2 abramowitz abramowitz NNP 4 abrams abram NNP 62 abrams abrams UNC 1 abramson abramson NNP 5 abrans abran NNS 1 abrant abrant NN 1 abrantes abrant NNP 1 abrase abrase NN 1 abrash abrash NNP 2 abrasion abrasion NN 7 abrasion-themed abrasion-themed JJ 1 abrasions abrasion NNS 6 abrasive abrasive JJ 23 abrasive abrasive NN 2 abrasive abrasive NNP 1 abrazo abrazo NN 1 abre abre NN 2 abre abre NNP 1 abre-like abre-like NNP 1 abreaction abreaction NN 1 abreast abreast NN 38 abreast abreast NNP 1 abrejo abrejo NNP 1 abrell abrell NNP 1 abres abr NNP 1 abreu abreu NNP 3 abreuvoir abreuvoir NNP 2 abri abrus NNP 1 abridge abridge NN 11 abridged abridged JJ 8 abridged abridged NNP 1 abridgement abridgement NN 1 abridges abridge NNS 1 abridging abridge VBG 3 abridgment abridgment NN 2 abridgment abridgment NNP 1 abriel abriel NN 1 abrigo abrigo NN 1 abrigo abrigo NNP 1 abrikosov abrikosov NNP 1 abril abril NNP 8 abril abril NN 1 abroad abroad RB 431 abroad abroad NNP 6 abroad abroad UNC 3 abroad abroad JJ 1 abroad-limits abroad-limit JJ 1 abrode abrode NN 1 abrogate abrogate NN 11 abrogated abrogated JJ 15 abrogates abrogate NNS 2 abrogating abrogate VBG 5 abrogation abrogation NN 8 abrotanum abrotanum NNP 3 abrou abrou NN 1 abrupt abrupt JJ 82 abrupta abrupta NN 1 abruptly abruptly RB 101 abruptly abruptly NNP 2 abruptness abruptness NNS 2 abruzzi abruzzus NNP 2 abs ab NNS 28 abs ab NNP 22 abs abs NN 1 absalom absalom NNP 6 absaroka absaroka NNP 1 abscam abscam NNP 2 abscence abscence NN 1 abscene abscene NN 1 abscess abscess NNS 9 abscess-like abscess-like JJ 1 abscessed abscessed JJ 1 abscesses abscess NNS 9 abscesses abscess NNP 1 abscessus abscessus JJ 1 abscisic abscisic JJ 6 abscisic abscisic NNP 1 abscissa abscissa NN 3 abscond abscond NN 3 absconded absconded JJ 4 absconding abscond VBG 1 abscondment abscondment NN 1 absdata absda NN 3 abse abse NNP 1 absence absence NN 1441 absence absence NNP 18 absence absence UNC 1 absence-minded absence-minded NNP 1 absences absence NNS 31 absense absense NN 1 absent absent JJ 379 absent absent VB 72 absent absent UNC 1 absent-minded absent-minded JJ 1 absent-mindedly absent-mindedly JJ 3 absente absente NNP 1 absented absented JJ 1 absentee absentee NN 47 absentee absentee NNP 2 absenteeism absenteeism NN 17 absenteeism absenteeism NNP 1 absentees absentee NNS 2 absenthe absenthe NNP 1 absentia absentia NN 6 absentia absentia NNP 3 absentionists absentionist NNS 1 absently absently RB 9 absentminded absentminded JJ 2 absentmindedly absentmindedly RB 1 abshire abshire NNP 1 absinth absinth NN 1 absinthe absinthe NN 8 absinthe absinthe NNP 2 absinthe-fueled absinthe-fueled JJ 1 absinthium absinthium NNP 13 absit absit NNP 1 absloutely absloutely NNP 1 abso-bleeding-lutely abso-bleeding-lutely NNP 1 abso-freakin-lutely abso-freakin-lutely NNP 1 abso-friggin abso-friggin JJ 1 abso-fucking-lutely abso-fucking-lutely NNP 1 abso-fucking-lutely abso-fucking-lutely JJ 1 absofxxxinglutely absofxxxinglutely NNP 1 absolete absolete NN 1 absolom absolom NNP 1 absolu absolu NN 1 absolut absolut NNP 4 absolute absolute JJ 745 absolute absolute UNC 1 absolute absolute NNP 1 absolute-beginners absolute-beginner JJ 1 absolutely absolutely RB 1404 absolutely absolutely JJ 1 absolutely absolutely NNP 1 absoluteness absoluteness NNS 5 absolutes absolute NNS 9 absolution absolution NN 11 absolutism absolutism NN 11 absolutisms absolutisms UNC 1 absolutist absolutist NN 14 absolutists absolutist NNS 1 absolutists absolutist NNP 1 absolutly absolutly RB 1 absolve absolve VBP 9 absolve absolve NNP 1 absolved absolved JJ 9 absolver absolver NN 1 absolves absolve NNS 3 absolves absolve NNP 1 absolving absolve VBG 2 absolyutno absolyutno NN 1 absorb absorb VB 113 absorb absorb VBP 13 absorb absorb NN 1 absorb absorb NNP 1 absorbable absorbable JJ 2 absorbance absorbance NN 133 absorbance absorbance NNP 8 absorbances absorbance NNS 4 absorbed absorb VBN 154 absorbed absorb VBD 43 absorbed absorbed UNC 3 absorbency absorbency NN 8 absorbency absorbency NNP 1 absorbent absorbent JJ 10 absorbent absorbent NNP 1 absorber absorber NN 61 absorber absorber NNP 2 absorber-module absorber-module JJ 2 absorbers absorber NNS 32 absorbing absorb VBG 63 absorbing absorbing NNP 2 absorbs absorb VBZ 28 absorptiometry absorptiometry NNP 2 absorption absorption NN 277 absorption absorption NNP 7 absorption absorption UNC 1 absorptions absorption NNS 1 absorptive absorptive JJ 3 absorptivities absorptivity NNS 1 abstain abstain NN 22 abstained abstain VBD 9 abstainers abstainer NNS 3 abstaining abstain VBG 6 abstains abstain NNS 2 abstemious abstemious JJ 2 abstemiousness abstemiousness NNS 1 abstention abstention NN 3 abstentions abstention NNS 5 abstinence abstinence NN 55 abstinence abstinence NNP 10 abstinence abstinence UNC 1 abstinence-based abstinence-based JJ 2 abstinence-only abstinence-only JJ 8 abstinence-oriented abstinence-oriented JJ 1 abstinence-plus abstinence-plus JJ 1 abstinent abstinent NN 3 abstinent abstinent NNP 1 abstract abstract JJ 263 abstract abstract NNP 30 abstract abstract UNC 2 abstractdataadapter abstractdataadapter NNP 1 abstracted abstracted JJ 36 abstracting abstract VBG 4 abstracting abstracting NNP 1 abstraction abstraction NN 58 abstraction abstraction NNP 1 abstractionist abstractionist NN 2 abstractions abstraction NNS 13 abstractly abstractly RB 8 abstractness abstractness NNS 1 abstractors abstractor NNS 3 abstracts abstract NNS 74 abstracts abstract NNP 12 abstruse abstruse NN 13 abstruse-seeming abstruse-seeming JJ 1 absurd absurd JJ 227 absurd absurd UNC 4 absurd absurd NNP 4 absurd-looking absurd-looking JJ 1 absurd-sounding absurd-sounding JJ 1 absurder absurder NNP 1 absurdism absurdism NN 1 absurdist absurdist NN 13 absurdist absurdist NNP 1 absurdist-tinged absurdist-tinged JJ 1 absurdities absurdity NNS 12 absurdity absurdity NN 51 absurdity absurdity NNP 3 absurdity absurdity UNC 1 absurdly absurdly RB 38 absurdly absurdly UNC 2 absurdum absurdum NN 3 absurdus absurdus NNP 1 absures absure NNP 1 abt abt NNP 19 abtei abteus NNP 1 abts abt NNP 4 abu abu NNP 218 abubakar abubakar NNP 12 abuela abuelum NN 1 abuela abuelum NNP 1 abuelo abuelo NN 7 abuelo abuelo NNP 4 abuen abuen NNP 1 abuja abuja NNP 1 abukayak abukayak NNP 1 abukhalil abukhalil NNP 3 abulia abulium NN 2 abulous abulous JJ 1 abumhrad abumhrad NNP 1 abundance abundance NN 399 abundance abundance NNP 3 abundances abundance NNS 27 abundant abundant JJ 292 abundant abundant NNP 12 abundantly abundantly RB 46 abundence abundence NN 1 abuot abuot NN 1 aburdeineh aburdeineh NNP 1 abusaad abusaad NNP 1 abusaid abusaid NNP 2 abuse abuse NN 970 abuse abuse NNP 106 abuse abuse VB 45 abuse abuse UNC 9 abuse-of-fiction abuse-of-fiction JJ 1 abuse-programs abuse-program JJ 1 abuse-suggesting abuse-suggesting JJ 1 abused abuse VBN 168 abused abuse VBD 21 abused abused NNP 10 abused abused JJ 2 abused abused UNC 1 abuseinfederal abuseinfederal NNP 2 abuseofpower abuseofpower NN 1 abuser abuser NN 18 abusers abuser NNS 35 abusers abuser NNP 4 abusers abusers UNC 1 abuses abuse NNS 206 abuses abuse NNP 7 abuses abuses UNC 1 abusing abuse VBG 86 abusing abusing NNP 4 abusive abusive JJ 146 abusive abusive NNP 2 abusive-cum-substance-abusive-cum-mooching abusive-cum-substance-abusive-cum-mooching JJ 1 abusively abusively RB 1 abut abut NN 11 abutments abutment NNS 1 abuts abut NNS 3 abutted abutted JJ 2 abutting abut VBG 5 abutting abutting NNP 1 abuturab abuturab NNP 1 abuzz abuzz JJ 7 abwab abwab NN 1 abwender abwender NNP 1 abx abx NNP 1 aby aby NN 1 abydos abydo NNP 1 abymes abyme NNP 1 abysii abysius NN 1 abysinth abysinth NN 1 abysmal abysmal NN 21 abysmally abysmally RB 3 abyss abyss NNS 17 abyss abyss NN 2 abyss abyss UNC 1 abyss-gazing abyss-gazing JJ 1 abyssi abyssus NN 11 abyssinia abyssinium NNP 7 abyssinian abyssinian NNP 2 abyssmally abyssmally RB 1 abzug abzug NNP 3 ab­bey ab­bey NN 1 ac ac NNP 245 ac ac NN 43 ac-hoteles ac-hotele JJ 2 aca aca NNP 31 aca aca NN 1 aca-limpia aca-limpium NNP 1 acaa acaa NNP 8 acaa acaa NN 2 acaaaaacc acaaaaacc NNP 1 acaaataggggttccgcgcaca acaaataggggttccgcgcaca NNP 1 acaacaaagggcagcaacaacacc acaacaaagggcagcaacaacacc NNP 1 acaacaccgtg acaacaccgtg NNP 1 acaaccagtttgctctgcttatc acaaccagtttgctctgcttatc NNP 1 acaba acaba NN 1 acacagataagttgctggcc acacagataagttgctggcc NNP 1 acacia acacia NN 6 acacia acacia NNP 2 acacia-like acacia-like JJ 1 acad acad NNP 19 academe academe NN 8 academe academe NNP 2 academese academese NN 1 academia academia NN 57 academia academia NNP 3 academic academic JJ 693 academic academic NNP 100 academic academic NN 39 academic academic UNC 3 academic-seeming academic-seeming JJ 1 academic-sounding academic-sounding JJ 1 academic-types academic-type JJ 1 academically academically RB 35 academician academician NN 2 academicians academician NNS 7 academicians academician NNP 1 academicism academicism NN 1 academics academic NNS 116 academics academic NNP 7 academic–industrial academic–industrial NN 1 academie academie NNP 4 academies academy NNS 12 academies academy NNP 4 academy academy NNP 356 academy academy NN 71 academy academy UNC 1 academywomen academywoman NN 1 acadia acadium NNP 14 acadia acadium NN 1 acadian acadian NNP 7 acadians acadian NNP 11 acadm acadm NNP 2 académica académica NNP 1 académie académie NNP 11 académie académie NN 1 académies académies NNP 1 acadé­mie acadé­mie NNP 1 acagcctgaccgtggagaag acagcctgaccgtggagaag NNP 1 acagtgaagagtagtggtcg acagtgaagagtagtggtcg NNP 1 acalda acalda NN 1 acampado acampado NN 1 acampora acampora NNP 2 acan acan NNP 1 acanthaceae acanthacea NNP 1 acanthamoeba acanthamoeba NNP 2 acanthomoeba acanthomoeba NNP 1 acanthostega acanthostega NNP 2 acanthus acanthus JJ 4 acap acap NN 1 acapella acapellum NN 2 acapulco acapulco NNP 90 acarbon acarbon NN 1 acarbose acarbose NN 1 acars acar NNP 7 acas aca NNP 2 acass acass NNP 1 acat acat NNP 1 acatccaaacagaacgtgcc acatccaaacagaacgtgcc NNP 1 acatcher acatcher NNP 1 acatggactgaggagtag acatggactgaggagtag NNP 1 acatgggacgtaacagatac acatgggacgtaacagatac NNP 1 acatgtccagcatcaaagcgg acatgtccagcatcaaagcgg NNP 1 acathala acathala NNP 1 acatitla acatitlum NNP 1 acatn acatn NNP 1 acaule acaule NN 1 acauses acause NNP 1 aca­demy aca­demy NNP 1 aca­dé­mie aca­dé­mie NNP 1 acbd acbd NNP 1 acc acc NNP 71 acc acc NN 3 accaccgtggacaccttctdtdt accaccgtggacaccttctdtdt NNP 1 accademia accademium NNP 14 accademia accademium NN 1 accadian accadian NNP 1 accaggacgatcaactgggcttc accaggacgatcaactgggcttc NNP 1 accagtcgactctacagtgc accagtcgactctacagtgc NNP 1 accattgagctcttcactgatgaacttcacc accattgagctcttcactgatgaacttcacc NNP 1 acccaagatacctcatcacag acccaagatacctcatcacag NNP 1 acccatgtcaaacccatcag acccatgtcaaacccatcag NNP 1 acccccatctcactaattcc acccccatctcactaattcc NNP 1 accclaimed accclaimed JJ 1 accctctccaaaatcccataa accctctccaaaatcccataa NNP 1 accede accede VB 11 acceded accede VBD 14 acceding accede VBG 4 accelerate accelerate VB 100 accelerate accelerate VBP 1 accelerate accelerate NNP 1 accelerate-the accelerate-the JJ 1 accelerated accelerate VBN 86 accelerated accelerate VBD 58 accelerated accelerated JJ 9 accelerated accelerated NNP 6 accelerates accelerate VBZ 17 accelerating accelerate VBG 58 acceleration acceleration NN 69 acceleration acceleration NNP 3 acceleration acceleration UNC 1 accelerations acceleration NNS 1 accelerator accelerator NN 17 accelerator accelerator NNP 2 accelerod accelerod NN 2 accelerometer accelerometer NN 1 accelerometer-based accelerometer-based JJ 3 accelerometers accelerometer NNS 1 acceleromyography acceleromyography NN 1 accelrys accelry NNP 1 accent accent NN 419 accent accent NNP 23 accent accent UNC 8 accent-free accent-free JJ 1 accent-reduction accent-reduction JJ 1 accent-training accent-training JJ 2 accented accented JJ 14 accenting accent VBG 6 accents accent NNS 130 accents accent NNP 15 accents-fighting-and-sweating-in-the-desert accents-fighting-and-sweating-in-the-desert JJ 1 accentservices accentservice NNP 1 accentuate accentuate NN 15 accentuate accentuate NNP 1 accentuated accentuated JJ 18 accentuated accentuated UNC 1 accentuates accentuate NNS 5 accentuating accentuate VBG 7 accenture accenture NNP 9 accep-tance accep-tance JJ 1 accept accept VB 865 accept accept VBP 150 accept accept NNP 15 accept accept UNC 2 accepta accepta NN 1 acceptab acceptab NN 1 acceptability acceptability NN 43 acceptability acceptability NNP 9 acceptable acceptable JJ 536 acceptable acceptable NNP 5 acceptable acceptable UNC 2 acceptableî acceptableî NN 1 acceptably acceptably RB 5 acceptance acceptance NN 323 acceptance acceptance NNP 18 acceptance acceptance UNC 2 acceptance-speech acceptance-speech JJ 1 acceptanceprocedures acceptanceprocedure NNS 1 acceptances acceptance NNS 10 accepted accept VBN 459 accepted accept VBD 447 accepted accepted NNP 18 accepted accepted JJ 9 accepted accepted UNC 5 accepter accepter NN 1 accepters accepter NNS 1 acceptible acceptible JJ 1 accepting accept VBG 272 accepting accepting NNP 9 accepting accepting UNC 1 acceptive acceptive JJ 1 acceptor acceptor NN 67 acceptor acceptor UNC 1 acceptors acceptor NNS 9 accepts accept VBZ 109 accepts accept NNP 1 accesorized accesorized JJ 1 access access NN 2085 access access NNP 226 access access VB 182 access access UNC 10 access access JJ 1 access-restriction access-restriction JJ 1 access-that access-that JJ 1 access-to-justice access-to-justice JJ 1 access-to-records access-to-record JJ 1 accessable accessable JJ 1 accessdata accessda NN 1 accessed accessed JJ 69 accessed accessed NNP 4 accessed-like accessed-like JJ 1 accesses access NNS 5 accessibilities accessibility NNS 1 accessibility accessibility NN 67 accessibility accessibility NNP 3 accessible accessible JJ 379 accessible accessible NNP 3 accessible accessible UNC 1 accessibly accessibly RB 3 accessing access VBG 42 accessing accessing NNP 3 accession accession NN 308 accession accession NNP 58 accession accession UNC 1 accessioned accessioned JJ 1 accessions accession NNS 14 accessionsperassembly accessionsperassembly RB 1 accessit accessit NN 1 accessories accessories UNC 1 accessories accessory NNS 75 accessories accessory NNP 1 accessorise accessorise NNP 1 accessorise accessorise NN 1 accessorize accessorize NN 6 accessorize accessorize NNP 1 accessorized accessorized JJ 3 accessorizing accessorize VBG 1 accessors accessor NNS 1 accessory accessory JJ 73 accessory accessory NNP 3 accessto accessto NN 1 accessworld accessworld NNP 1 accgtgaaaagatgatgacccag accgtgaaaagatgatgacccag NNP 1 accgtgaccg accgtgaccg NNP 1 acch acch NNP 1 accha accha NN 1 accham accham NNP 1 acci acci NN 1 acci accus NNP 1 accid accid NNP 1 accident accident NN 631 accident accident NNP 39 accident accident UNC 2 accident accident JJ 1 accident-prone accident-prone JJ 2 accident-related accident-related JJ 1 accidental accidental NN 113 accidental accidental NNP 18 accidentalis accidentali NNS 1 accidentally accidentally RB 206 accidentally accidentally NNP 2 accidently accidently RB 14 accidents accident NNS 226 accidents accident NNP 7 accidents accidents UNC 2 accidents accidents JJ 1 acciderant acciderant NN 1 accidnet accidnet NN 1 accio accio NN 1 accipiens accipien NNS 1 accipitrine accipitrine NN 1 accival accival NNP 1 acclaim acclaim NN 51 acclaim acclaim NNP 3 acclaim acclaim UNC 1 acclaim acclaim VB 1 acclaimed acclaimed JJ 83 acclaimed acclaimed NNP 3 acclamabant acclamabant NN 1 acclamation acclamation NN 4 acclimatation acclimatation NNP 3 acclimate acclimate NN 8 acclimated acclimated JJ 19 acclimating acclimate VBG 6 acclimating acclimating NNP 1 acclimation acclimation NN 21 acclimation acclimation NNP 2 acclimatization acclimatization NN 4 acclimatize acclimatize NN 4 acclimatized acclimatized JJ 1 accn accn NNP 1 accnewsmedia accnewsmedium NN 1 accnu accnu NNP 1 acco acco NNP 12 acco acco NN 1 accoberry accoberry NNP 1 accolade accolade NN 11 accolades accolade NNS 24 accom accom NN 1 accomadating accomadate VBG 1 accommodate accommodate VB 211 accommodate accommodate VBP 8 accommodated accommodate VBN 33 accommodates accommodate NNS 19 accommodating accommodate VBG 37 accommodating accommodating NNP 1 accommodatingly accommodatingly NNP 1 accommodation accommodation NN 83 accommodation accommodation NNP 2 accommodation accommodation UNC 1 accommodationism accommodationism NN 2 accommodationist accommodationist NN 5 accommodationists accommodationist NNS 1 accommodations accommodation NNS 104 accommodations accommodation NNP 7 accommodations accommodations UNC 1 accomodate accomodate VB 8 accomodation accomodation NN 5 accomodationists accomodationist NNS 1 accomodations accomodation NNS 2 accompanied accompanied NNP 7 accompanied accompanied UNC 3 accompanied accompany VBN 380 accompanied accompany VBD 58 accompanies accompany VBZ 62 accompanies accompany NNP 1 accompaniment accompaniment NN 26 accompaniments accompaniment NNS 3 accompaniments accompaniment NNP 3 accompanist accompanist NN 3 accompany accompany VB 118 accompany accompany NNP 3 accompanying accompany VBG 261 accompanying accompanying NNP 12 accompianied accompianied JJ 1 accompianment accompianment NN 2 accompli accompli NN 10 accomplice accomplice NN 31 accomplice accomplice UNC 1 accomplices accomplice NNS 19 accomplis accompli NNS 1 accomplish accomplish VB 277 accomplish accomplish NNP 1 accomplish accomplish JJ 1 accomplish-easily accomplish-easily JJ 1 accomplished accomplish VBN 360 accomplished accomplished JJ 4 accomplished accomplished NNP 2 accomplished accomplished UNC 1 accomplishes accomplish VBZ 17 accomplishing accomplish VBG 47 accomplishment accomplishment NN 117 accomplishment accomplishment UNC 2 accomplishment accomplishment NNP 1 accomplishments accomplishment NNS 138 accomplishments accomplishment NNP 5 accomplit accomplit NN 1 accompong accompong NNP 1 accord accord NN 132 accord accord NNP 44 accord accord VB 4 accord accord JJ 1 accord accord UNC 1 accordance accordance NN 386 accordance accordance NNP 2 accordancewith accordancewith NN 1 accordant accordant NN 1 accorded accord VBN 32 accorded accord VBD 16 accordence accordence NN 1 accordianist accordianist NN 1 accordians accordian NNS 1 according accord VBG 5106 according according UNC 7 accordingly accordingly RB 275 accordingly accordingly UNC 1 accordion accordion NN 29 accordion accordion NNP 3 accordion-laced accordion-laced JJ 1 accordion-like accordion-like JJ 1 accordionated accordionated NNP 1 accordionist accordionist NN 4 accordions accordion NNS 12 accords accord NNS 67 accords accord NNPS 14 accords accords UNC 1 accoring accore VBG 1 accorsi accorsus NNP 1 accosted accosted JJ 11 accosting accost VBG 3 accosts accost NNS 1 account account NN 1604 account account VB 406 account account VBP 158 account account NNP 36 account account UNC 10 account account JJ 1 accountabilities accountability NNS 2 accountability accountability NN 380 accountability accountability NNP 85 accountability-can accountability-can JJ 1 accountability-with accountability-with JJ 1 accountabilitycontrol accountabilitycontrol NNP 1 accountabilityreportis accountabilityreporti NNP 1 accountable accountable JJ 224 accountable accountable NNP 6 accountable accountable UNC 1 accountancy accountancy NN 9 accountancy accountancy NNP 3 accountant accountant NN 109 accountant accountant NNP 7 accountant-client accountant-client JJ 1 accountantand accountantand NN 1 accountants accountant NNS 118 accountants accountant NNPS 61 accountants accountant NNP 2 accountants accountants NNP 2 accountants accountants UNC 1 accountants-www accountants-www NNP 2 accounted account VBD 161 accounted account VBN 115 accounted accounted NNP 1 accounting account VBG 91 accounting accounting NN 1446 accounting accounting NNP 536 accounting accounting UNC 2 accounting-fraud accounting-fraud JJ 1 accounting-oversight accounting-oversight JJ 1 accountingmalpractice accountingmalpractice NNP 1 accountingrelated accountingrelated JJ 1 accounts account NNS 908 accounts account NNPS 60 accounts account VBZ 60 accounts account NNP 8 accounts accounts UNC 3 accounts-and accounts-and JJ 1 accounts-and accounts-and NNP 1 accounts-discussed accounts-discussed JJ 1 accounts-to accounts-to JJ 1 accout accout NN 1 accouterment accouterment NN 2 accouterments accouterment NNS 5 accoutred accoutred JJ 1 accoutrements accoutrements NNS 12 accra accra NNP 12 accreditation accreditation NN 22 accreditation accreditation NNP 15 accreditation accreditation UNC 1 accreditations accreditation NNS 1 accredited accredited JJ 25 accrediting accredit VBG 5 accredits accredit NNS 3 accreted accrete VBN 2 accreting accrete VBG 1 accretion accretion NN 17 accretions accretion NNS 3 accross accross NNS 1 accrual accrual NN 10 accrual accrual NNP 2 accrue accrue VB 35 accrue accrue UNC 1 accrued accrue VBN 42 accrues accrue VBZ 8 accruing accrue VBG 9 acct acct NN 2 acctcccaaactatagattgggtg acctcccaaactatagattgggtg NNP 1 acctgcactc acctgcactc NNP 1 acctran acctran NNP 2 accttattttaaaaataaagttaa accttattttaaaaataaagttaa NNP 1 accttggaagaaccaaatc accttggaagaaccaaatc NNP 1 accu accu NN 1 accucam accucam NNP 1 accueillir accueillir NN 1 accugel accugel NNP 1 acculturated acculturated JJ 3 acculturating acculturate VBG 2 acculturation acculturation NN 6 acculturation acculturation NNP 1 accumbens accumben NNS 5 accumbens accumbens UNC 1 accumen accuman NN 1 accummulated accummulated JJ 1 accumulate accumulate VBP 169 accumulated accumulate VBN 200 accumulated accumulated NNP 3 accumulates accumulate NNS 60 accumulating accumulate VBG 73 accumulating accumulating NNP 7 accumulation accumulation NN 483 accumulation accumulation NNP 4 accumulations accumulation NNS 16 accumulations accumulation NNP 2 accumulative accumulative JJ 1 accumulators accumulator NNS 2 accupressure accupressure NN 2 accur accur NN 1 accurac accurac NN 1 accuracies accuracy NNS 7 accuracy accuracy NN 642 accuracy accuracy NNP 25 accuracy-the accuracy-the JJ 1 accuradio accuradio NNP 2 accurate accurate JJ 868 accurate accurate NNP 28 accurate accurate UNC 3 accurately accurately RB 366 accurately accurately UNC 2 accurately accurately NNP 2 accuratelymodel accuratelymodel NN 1 accuray accuray NN 1 accurist accurist NNP 1 accurs accur NNS 1 accursed accursed JJ 2 accursed accursed NNP 1 accus accus NN 1 accusation accusation NN 108 accusation accusation NNP 1 accusational accusational NN 1 accusations accusation NNS 202 accusations accusation NNP 6 accusations accusations UNC 3 accusative accusative JJ 6 accusatory accusatory JJ 9 accuse accuse VBP 75 accuse accuse VB 69 accuse accuse NNP 2 accused accuse VBN 575 accused accuse VBD 304 accused accused NNP 21 accused accused UNC 2 accuser accuser NN 31 accuser accuser UNC 1 accusers accuser NNS 25 accuses accus NNP 1 accuses accusee VBZ 109 accuses accuses UNC 1 accusing accuse VBG 151 accusing accusing NNP 2 accusing accusing UNC 1 accusingly accusingly RB 4 accusitive accusitive JJ 3 accustom accustom NN 3 accustomed accustom VBN 142 accustomed accustomed JJ 6 accustomed accustomed NNP 1 accutron accutron NNP 20 accutrons accutron NNP 4 accuvue accuvue NNP 1 accuweather accuweather NNP 4 accuzyme accuzyme NNP 1 accytnarggt accytnarggt NNP 1 acd acd NNP 8 acdcrocks acdcrock NNS 1 ace ace NNP 87 ace ace NN 75 ace-i ace-us NNP 4 ace-inhibitor ace-inhibitor NNP 2 ace-inhibitors ace-inhibitor NNP 7 acea acea NNP 1 acebuche acebuche NNP 1 acecray acecray NN 1 aced aced JJ 6 acedb acedb NNP 6 aceee aceee NNP 3 aceh aceh NNP 14 acehnese acehnese NNP 4 aceisms aceism NNP 2 aceitunasoliveslangostaspiny aceitunasoliveslangostaspiny NN 1 acela acelum NNP 10 acellular acellular NN 1 acentric acentric JJ 1 aceous aceous NNP 1 acequia acequium NN 1 acer acer NNP 4 aceralia aceralium NNP 1 acerbic acerbic JJ 14 acerbity acerbity NN 1 acert acert NNP 1 aces ace VBZ 30 aces ace NNP 9 acess acess NNS 1 acesulfame acesulfame NN 2 acetabularia acetabularium NNP 4 acetabulum acetabulum NN 2 acetaminophen acetaminophen NN 14 acetaminophen acetaminophen NNP 1 acetate acetate NN 180 acetate acetate NNP 10 acetates acetate NNS 1 acetazolamide acetazolamide NN 23 acetazolamide acetazolamide NNP 3 acetazolamide-induced acetazolamide-induced JJ 1 acetazolamide-induced acetazolamide-induced NNP 1 acetic acetic JJ 49 acetic acetic NNP 1 acetivorans acetivoran NNS 4 acetobutylicum acetobutylicum NN 13 acetol acetol NN 1 acetomeniphin acetomeniphin NN 1 acetominophen acetominophen NN 1 acetone acetone NN 41 acetone acetone NNP 3 acetone-dried acetone-dried JJ 5 acetone-dry acetone-dry JJ 1 acetonitrile acetonitrile NN 22 acetonitrile acetonitrile NNP 1 acetoxylmethyl acetoxylmethyl NN 1 acetoxymethyl acetoxymethyl NN 8 acetoxymethylester acetoxymethylester NN 2 acetyl acetyl NN 64 acetyl-leu-leu-norleucinal acetyl-leu-leu-norleucinal JJ 1 acetyl-leucyl-leucyl-norleucinal acetyl-leucyl-leucyl-norleucinal NNP 1 acetyl-leucyl-leucyl-norleucinal acetyl-leucyl-leucyl-norleucinal JJ 1 acetyl-transferase acetyl-transferase JJ 1 acetyl-transferases acetyl-transferase JJ 1 acetylase acetylase NN 2 acetylated acetylated JJ 20 acetylation acetylation NN 33 acetylbarlerin acetylbarlerin NN 1 acetylcholine acetylcholine NN 69 acetylcholine acetylcholine NNP 4 acetylcholine-mediated acetylcholine-mediated JJ 1 acetylcholine-stimulated acetylcholine-stimulated JJ 1 acetylcholinesterase acetylcholinesterase NN 4 acetylcysteine acetylcysteine NN 3 acetylenic acetylenic JJ 1 acetylglucosamine acetylglucosamine NN 1 acetylhydorolase acetylhydorolase NNP 1 acetyllysines acetyllysine NNS 1 acetylmuramate acetylmuramate NN 3 acetylornithine acetylornithine NN 1 acetyloxy acetyloxy NN 2 acetylsalicylic acetylsalicylic JJ 1 acetylserine acetylserine NN 1 acetylshanzhiside acetylshanzhiside NN 1 acetyltransferase acetyltransferase NN 35 acetyltransferases acetyltransferase NNS 3 acevedo acevedo NNP 3 aceves aceve NNP 2 acf acf NNP 15 acf acf NN 1 acfirmi acfirmus NNP 7 acg acg NNP 20 acg acg NN 2 acgaacagcatctcct acgaacagcatctcct NNP 1 acgcgcggagttggc acgcgcggagttggc NNP 1 acgcgttgcgtatcgcgcg acgcgttgcgtatcgcgcg NNP 1 acggcttttcc acggcttttcc NNP 1 acgme acgme NNP 3 acgtca acgtca NNP 1 acgtgc acgtgc NNP 1 acgttgcgagctgctgcggc acgttgcgagctgctgcggc NNP 2 ach ach NNP 80 ach ach NN 5 achada achada NNP 4 achaean achaean NNP 1 achaeans achaean NNP 3 achaiac achaiac NNP 1 achange achange NN 1 achapman achapman NN 2 achbp achbp NNP 33 ache ache NN 37 ache ache NNP 1 achebe achebe NNP 4 ached ached JJ 5 acheh acheh NNP 2 acheive acheive JJ 3 acheived acheived JJ 3 acheivement acheivement NN 2 achenbach achenbach NNP 4 aches ache NNS 27 acheson acheson NNP 52 achey achey NN 11 acheyness acheyness NNS 1 achh achh NNP 1 achiasmatic achiasmatic JJ 22 achievable achievable JJ 33 achievable achievable NNP 3 achieve achieve VB 877 achieve achieve VBP 60 achieve achieve NNP 11 achieved achieve VBN 615 achieved achieve VBD 152 achieved achieved NNP 6 achieved achieved UNC 2 achieved-can achieved-can JJ 1 achievedby achievedby NN 1 achievement achievement NN 331 achievement achievement NNP 19 achievement achievement JJ 2 achievement achievement UNC 1 achievements achievement NNS 154 achievements achievement NNP 15 achievements achievements UNC 3 achiever achiever NN 3 achiever achiever NNP 1 achievers achiever NNS 9 achievers achievers UNC 1 achieves achieve VBZ 67 achieves achieve NNP 1 achieves achieves NN 1 achieving achieve VBG 279 achieving achieving NNP 28 achieving achieving UNC 1 achille achille NNP 1 achillea achillea NN 1 achilles achille NNP 41 achilles achille NNS 2 aching ache VBG 42 achingly achingly RB 6 achingly-long achingly-long JJ 1 achiron achiron NNP 1 achives achive NNS 1 achla achlum NNP 1 achlamu achlamu NNP 1 achmed achmed NNP 38 achner achner NN 1 achomawi achomawus NNP 2 achomawi achomawus NN 1 achondroplastic achondroplastic UNC 1 achoo achoo NN 1 achos acho NNS 1 achr achr NNP 26 achromatic achromatic JJ 1 achromatopic achromatopic JJ 1 achromatopsia achromatopsia UNC 1 achromatopsia achromatopsium NN 1 achrs achr NNP 13 acht acht NNP 1 achterburg achterburg NNP 1 achtgroschenjunge achtgroschenjunge NNP 2 achtung achtung NNP 3 achy achy NN 6 achy achy NNP 1 aci aci NN 1 aci acus NNP 113 acid acid NN 2030 acid acid NNP 105 acid acid UNC 2 acid acid JJ 1 acid-albumin-dextrose-catalase acid-albumin-dextrose-catalase JJ 1 acid-alcohol-formalin acid-alcohol-formalin JJ 1 acid-base acid-base JJ 3 acid-based acid-based JJ 5 acid-binding acid-binding JJ 4 acid-blooded acid-blooded JJ 1 acid-citrate-dextrose acid-citrate-dextrose JJ 1 acid-containing acid-containing JJ 1 acid-denatured acid-denatured JJ 1 acid-fast acid-fast JJ 4 acid-filled acid-filled JJ 1 acid-free acid-free JJ 2 acid-induced acid-induced JJ 4 acid-long acid-long JJ 1 acid-mediated acid-mediated JJ 2 acid-nucleotide acid-nucleotide JJ 1 acid-phenol acid-phenol JJ 1 acid-phosphate acid-phosphate JJ 1 acid-reactive acid-reactive JJ 2 acid-rich acid-rich JJ 1 acid-soaked acid-soaked JJ 1 acid-stable acid-stable JJ 1 acid-stimulated acid-stimulated JJ 1 acid-tolerant acid-tolerant JJ 3 acid-tolerant acid-tolerant NNP 1 acid-tongued acid-tongued JJ 2 acid-transporting acid-transporting JJ 2 acid-treated acid-treated JJ 8 acid-tris acid-tri JJ 2 acid-urea acid-urea JJ 2 acid-washing acid-washing JJ 1 acid-worded acid-worded JJ 1 acidarmanus acidarmanus JJ 1 acidemia acidemium NN 4 acidemias acidemia NNS 2 acidic acidic JJ 167 acidic acidic NNP 4 acidification acidification NN 14 acidification acidification NNP 3 acidified acidify VBN 13 acidify acidify NN 2 acidimetry acidimetry NN 1 acidiphilum acidiphilum NNP 1 acidithiobacillus acidithiobacillus NNP 1 acidity acidity NN 37 acidly acidly RB 4 acidogenic acidogenic JJ 1 acidop acidop NN 1 acidophilous acidophilous JJ 1 acidophilum acidophilum NN 35 acidophiluma-atpase acidophiluma-atpase JJ 1 acidophilumintein acidophilumintein NN 1 acidophilus acidophilus JJ 4 acidopholus acidopholus JJ 1 acidosis acidosis NNS 27 acidosis acidosis NNP 1 acids acid NNS 1075 acids acid NNP 4 acids acids UNC 3 aciduria acidurium NN 18 acid– acid– NN 2 acid–glutamic acid–glutamic JJ 1 acid–leucine acid–leucine NN 1 acinar acinar NN 4 acinetobacter acinetobacter NNP 12 acing ace VBG 3 acing acing NNP 1 acini acinus NN 14 acipenser acipenser NNP 3 acipenseriformes acipenseriform NNP 2 acis aci NNP 1 acitivy acitivy NN 1 acitotinase acitotinase NN 1 acitrate acitrate NN 1 aciv aciv NNP 1 ack ack NNP 72 ack ack NN 9 ackab ackab NN 3 ackee ackee NN 4 acker acker NNP 33 ackerly ackerly NNP 2 ackerman ackerman NNP 13 ackermann ackermann NNP 9 ackil ackil NNP 3 ackland ackland NNP 1 acklins acklin NNP 4 acknolwedge acknolwedge NN 1 acknowledge acknowledge VB 165 acknowledge acknowledge VBP 116 acknowledge acknowledge UNC 1 acknowledge acknowledge NNP 1 acknowledged acknowledge VBD 332 acknowledged acknowledge VBN 114 acknowledged acknowledged JJ 1 acknowledgedly acknowledgedly RB 1 acknowledgement acknowledgement NN 38 acknowledgement acknowledgement NNP 2 acknowledgements acknowledgement NNP 10 acknowledgements acknowledgement NNS 7 acknowledges acknowledge VBZ 134 acknowledges acknowledge NNP 1 acknowledges acknowledges UNC 1 acknowledging acknowledge VBG 96 acknowledging acknowledging NNP 8 acknowledgment acknowledgment NN 46 acknowledgment acknowledgment UNC 3 acknowledgment acknowledgment NNP 2 acknowledgments acknowledgment NNS 10 acknowledgments acknowledgment NNP 9 acknowlnotes acknowlnote NN 1 ackroyd ackroyd NNP 6 acl acl NNP 17 acl acl NN 4 acland acland NNP 1 acleod acleod NN 1 aclivmfy aclivmfy NNP 2 acls acl NNP 2 aclu aclu NNP 48 aclu aclu UNC 1 acly acly NNP 10 acm acm NNP 14 acmb acmb NNP 9 acmb-like acmb-like NNP 2 acme acme NNP 8 acme acme NN 2 acmed acmed NNP 1 acmepet acmepet NNP 1 acmm acmm NNP 1 acmnpv acmnpv NNP 4 acn acn NNP 2 acnab acnab NN 4 acne acne NN 8 acne acne NNP 1 acne-free acne-free JJ 1 acno acno NN 1 acnv acnv NNP 1 aco aco NNP 2 acoa acoa NNP 2 acocella acocellum NNP 2 acocmplish acocmplish NN 1 acoel acoel NN 1 acoelomate acoelomate NN 1 acog acog NN 2 acog acog NNP 1 acoh acoh NNP 1 acolman acolman NNP 1 acolyte acolyte NN 7 acolytes acolyte NNS 13 acoma acoma NNP 4 acombined acombined JJ 1 acompany acompany NNP 1 acompared acompared NNP 1 acompares acompare NNP 1 acondition acondition NN 1 aconfession aconfession NNP 1 aconfirms aconfirm NNP 1 aconi aconi NN 1 aconicitrate aconicitrate NN 1 aconitase aconitase NN 11 aconitase aconitase NNP 1 aconite aconite NN 1 acononate acononate NN 1 acord acord NNP 1 acorn acorn NN 7 acorn acorn NNP 2 acorn-shape acorn-shape JJ 1 acorns acorn NNS 6 acosta acosta NNP 5 acosts acost NNS 1 acoustic acoustic JJ 72 acoustic acoustic NNP 8 acoustical acoustical JJ 5 acoustical acoustical NNP 1 acoustically acoustically RB 9 acoustics acoustic NNS 42 acoustics acoustic NNP 1 acoustiguide acoustiguide NN 1 acoustra acoustra NNP 1 acovers acover NNS 1 acp acp NNP 9 acpa acpa NN 2 acps acp NNP 1 acq acq NNP 1 acqua acqua NN 1 acquaint acquaint NN 5 acquaintance acquaintance NN 88 acquaintance acquaintance NNP 1 acquaintances acquaintance NNS 49 acquaintances acquaintance NNP 7 acquaintanceship acquaintanceship NN 1 acquaintanceships acquaintanceship NNS 1 acquainted acquaint VBN 59 acquainted acquainted NNP 1 acquainting acquaint VBG 1 acquaints acquaint NNS 1 acquiesce acquiesce VB 4 acquiesced acquiesce VBD 9 acquiescence acquiescence NN 12 acquiescent acquiescent NN 3 acquiesces acquiesce NNS 1 acquiescing acquiesce VBG 3 acquiesence acquiesence NN 1 acquire acquire VB 319 acquire acquire NN 13 acquire acquire NNP 5 acquire acquire UNC 2 acquireagency acquireagency NN 1 acquired acquire VBN 499 acquired acquire VBD 207 acquired acquired JJ 2 acquired acquired UNC 1 acquiree acquiree NN 1 acquirees acquiree NNS 1 acquirer acquirer NN 7 acquirers acquirer NNS 5 acquires acquire VBZ 24 acquires acquire NNP 1 acquiring acquire VBG 182 acquiring acquiring NNP 14 acquisition acquisition NN 642 acquisition acquisition NNP 144 acquisition-driven acquisition-driven JJ 1 acquisition-in-process acquisition-in-process JJ 1 acquisitionas acquisitiona NNS 1 acquisitionofficials acquisitionofficial NNS 1 acquisitions acquisition NNS 142 acquisitions acquisitions UNC 1 acquisitive acquisitive JJ 4 acquisitiveness acquisitiveness NNS 3 acquit acquit VB 18 acquits acquit NNS 3 acquits acquit NNP 1 acquittal acquittal NN 46 acquittal acquittal UNC 1 acquittal acquittal NNP 1 acquittals acquittal NNS 8 acquitted acquit VBN 60 acquitted acquitted NNP 2 acquitted acquitted UNC 1 acquitting acquit VBG 4 acqusitive acqusitive JJ 1 acr acr NNP 32 acr acr NN 1 acral acral NN 2 acrasin acrasin NN 2 acre acre NN 231 acre acre NNP 23 acreage acreage NN 18 acreage acreage NNP 1 acreman acreman NN 1 acres acre NNS 395 acres acre NNP 17 acres acres UNC 1 acrid acrid NN 13 acridine acridine NN 13 acrimonious acrimonious JJ 9 acrimony acrimony NN 10 acrimony acrimony NNP 1 acrisius acrisius NNP 2 acritude acritude NN 1 acro acro NN 2 acrobat acrobat NNP 13 acrobat acrobat NN 7 acrobatic acrobatic JJ 17 acrobatic acrobatic NNP 2 acrobatically acrobatically RB 2 acrobatics acrobatics NNS 12 acrobatics acrobatics NNP 3 acrobats acrobat NNS 4 acrobats acrobat NNP 4 acrocentric acrocentric JJ 4 acrocentrics acrocentric NNS 1 acrocomia acrocomium NNP 2 acrocorinth acrocorinth NNP 1 acrolein acrolein NN 1 acromegaly acromegaly RB 4 acronical acronical JJ 1 acronym acronym NN 76 acronym acronym NNP 6 acronym acronym JJ 1 acronym-farm acronym-farm NNP 1 acronymalicious acronymalicious JJ 1 acronymed acronymed JJ 2 acronymic acronymic JJ 2 acronymized acronymized JJ 1 acronyms acronym NNS 56 acronyms acronym NNP 6 acronyms acronyms UNC 1 acropolis acropoli NNP 49 acropolis acropoli NNS 3 acropper acropper NN 1 acros acro NNS 1 acrosomal acrosomal NN 1 acrosome acrosome NN 1 across across IN 4338 across across UNC 8 across across RP 6 across across NNP 6 across-array across-array JJ 1 across-array-design across-array-design JJ 1 across-sites across-site JJ 1 across-study across-study NNP 4 across-the-board across-the-board JJ 31 across-the-board-pay across-the-board-pay JJ 1 across-the-top across-the-top JJ 2 acrosss acrosss NNS 1 acrossthe acrossthe NN 1 acrostic acrostic JJ 3 acrostics acrostic NNS 2 acrostics acrostic NNP 1 acrybp acrybp NNP 1 acrydite acrydite NN 1 acrylamide acrylamide NN 22 acrylamide-urea acrylamide-urea JJ 1 acrylate acrylate NN 1 acrylic acrylic JJ 9 acrylic acrylic NNP 2 acrylics acrylic NNS 1 acr­oss acr­oss NNS 1 acs ac NNP 59 acs-grade acs-grade NNP 1 acse acse NN 4 acse-hp acse-hp JJ 4 acsension acsension NNP 1 acsf acsf NNP 6 acshun acshun NN 1 acsp acsp NNP 1 act act NNP 2070 act act NN 1117 act act VB 671 act act VBP 176 act act UNC 12 act act JJ 1 act-containing act-containing JJ 2 act-expressing act-expressing JJ 2 act-like act-like NNP 1 act-strategic act-strategic NNP 1 act-up-style act-up-style NNP 1 act-which act-which NNP 4 acta acta NN 20 acta acta NNP 2 acta-dependent acta-dependent NNP 2 actaatgctag actaatgctag NNP 1 actaea actaea NNP 6 actaeas actaea NNS 1 actaeon actaeon NNP 2 actagtctcgagt actagtctcgagt NNP 1 actastrains actastrain NNS 1 actate actate NN 1 actb actb NNP 4 actccaaggctctcaacgaa actccaaggctctcaacgaa NNP 1 actd actd NNP 7 acted act VBD 255 acted act VBN 104 acted acted UNC 1 actess actess NNS 1 acteylated acteylated JJ 1 actgacgaattcagccaccatggcgctcctgctgtgc actgacgaattcagccaccatggcgctcctgctgtgc NNP 1 actgattttg actgattttg NNP 1 actgcgaagatccactga actgcgaagatccactga NNP 1 actggt actggt NNP 1 actgtg actgtg NNP 1 actgtggctactcagctgtg actgtggctactcagctgtg NNP 1 acth acth NNP 41 actifed actifed NNP 1 actillume actillume NNP 5 actin actin NN 395 actin actin NNP 14 actin-?-galactosidase actin-?-galactosidase JJ 1 actin-activated actin-activated JJ 2 actin-associated actin-associated JJ 1 actin-based actin-based JJ 12 actin-based actin-based NNP 1 actin-binding actin-binding JJ 17 actin-containing actin-containing JJ 1 actin-cytoskeletal actin-cytoskeletal JJ 1 actin-dependent actin-dependent JJ 3 actin-depolymerizing actin-depolymerizing JJ 1 actin-filament actin-filament JJ 1 actin-filled actin-filled JJ 1 actin-fragmin actin-fragmin JJ 1 actin-like actin-like JJ 1 actin-modulating actin-modulating JJ 1 actin-myosin actin-myosin JJ 5 actin-rich actin-rich JJ 3 acting act VBG 849 acting acting NN 138 acting acting NNP 31 acting acting UNC 9 acting-class acting-class JJ 2 acting-out acting-out JJ 2 acting-wise acting-wise JJ 4 actinic actinic JJ 7 actinic actinic NNP 1 actinide actinide NNP 1 actinin actinin NNP 1 actinobacillus actinobacillus NNP 1 actinobacteria actinobacterium NNP 5 actinobacteria actinobacterium NN 2 actinobacterial actinobacterial NN 1 actinomycetales actinomycetale NNP 2 actinomycete actinomycete NN 3 actinomycete actinomycete NNP 1 actinomycetemcomitans actinomycetemcomitan NNS 2 actinomycetes actinomycete NNS 4 actinomycetes actinomycete NNP 4 actinomycetes actinomycetes NNP 1 actinomycin actinomycin NN 16 actinomycin actinomycin NNP 2 actinomycin-based actinomycin-based JJ 1 actinopterygian actinopterygian NN 2 actinopterygians actinopterygian NNS 1 actinopterygii actinopterygius NNP 1 actinorhodin actinorhodin NN 1 actins actin NNS 1 actin–myosin actin–myosin NN 1 action action NN 2939 action action NNP 220 action action UNC 12 action-adventure action-adventure JJ 4 action-and-doing action-and-doing JJ 2 action-and-goal action-and-goal JJ 1 action-comedy action-comedy JJ 1 action-figure action-figure JJ 3 action-filled action-filled JJ 1 action-film action-film JJ 1 action-movie action-movie NNP 1 action-oriented action-oriented JJ 2 action-packed action-packed JJ 9 action-performance action-performance JJ 1 action-plan action-plan JJ 1 action-related action-related JJ 1 action-the action-the JJ 1 action-thriller action-thriller JJ 1 actionable actionable JJ 20 actionalert actionalert NN 1 actioner actioner NN 1 actioners actioner NNS 1 actionless actionless JJ 1 actionmeasurement actionmeasurement NN 2 actions action NNS 1169 actions action NNP 54 actions actions UNC 5 actions-spending actions-spending JJ 1 actiony actiony NN 1 activa activa NNP 4 activase activase NN 2 activatable activatable JJ 1 activate activate VBP 319 activate activate NNP 2 activated activate VBN 773 activated activated NNP 36 activates activate NNS 140 activates activate NNP 1 activating activate VBG 109 activating activating NNP 2 activation activation NN 1684 activation activation NNP 66 activation-induced activation-induced JJ 13 activation-regulated activation-regulated JJ 1 activation-related activation-related JJ 1 activations activation NNS 1 activations activation NNP 1 activationâ activationâ NN 1 activator activator NN 127 activator activator NNP 3 activators activator NNS 71 activats activat NNS 1 active active JJ 1693 active active NNP 7 active-control active-control JJ 1 active-controlled active-controlled JJ 3 active-duty active-duty JJ 15 active-site active-site JJ 10 actively actively RB 279 actively actively UNC 2 actively-traded actively-traded JJ 1 activelytraded activelytraded JJ 1 activeperl activeperl NNP 1 actives active NNS 3 actives active NNP 1 activestate activestate NNP 1 activewear activewear NNP 1 activewear activewear NN 1 activex activex NNP 9 activie activie NN 1 activies activy NNS 1 activin activin NN 5 activision activision NNP 1 activism activism NN 77 activism activism NNP 1 activist activist NN 165 activist activist NNP 6 activist activist JJ 1 activists activist NNS 256 activists activists JJ 1 activites activite NNS 1 activities activities UNC 7 activities activities NNP 2 activities activity NNS 2104 activities activity NNPS 85 activities activity NNP 1 activities-taking activities-taking JJ 1 activities-terrorist activities-terrorist JJ 1 activity activity NN 4286 activity activity UNC 12 activity activity NNP 6 activity-based activity-based JJ 4 activity-based activity-based NNP 1 activity-center activity-center JJ 1 activity-dependent activity-dependent JJ 9 activity-dependent activity-dependent NNP 2 activity-independent activity-independent JJ 2 activity-induced activity-induced JJ 1 activity-labeling activity-labeling JJ 1 activity-plasmid activity-plasmid JJ 1 activity-regarded activity-regarded JJ 1 activitybased activitybased JJ 1 activization activization NNP 1 activty activty NN 1 actly actly RB 1 actmutation actmutation NN 1 acto acto NN 2 actof actof NNP 2 actogram actogram NN 2 actograms actogram NNS 2 actograms actogram NNP 1 actomyosin actomyosin NN 11 acton acton NNP 19 actonel actonel NNP 3 actor actor NN 768 actor actor NNP 53 actor actor UNC 4 actor-director actor-director JJ 3 actor-director actor-director NNP 1 actor-director-writer actor-director-writer NNP 1 actor-essayist-blogger actor-essayist-blogger JJ 1 actor-lossage actor-lossage JJ 1 actor-politician actor-politician JJ 1 actorboy actorboy NN 1 actorcasting actorcast VBG 1 actors actor NNS 653 actors actor NNP 40 actors actors UNC 9 actors actors JJ 1 actors-playing-the-same-characters actors-playing-the-same-character JJ 1 actors-turned-directors actors-turned-director JJ 1 actory actory NN 2 actos acto NNS 3 actovegin actovegin NNP 1 actprotein actprotein NN 1 actr actr NNP 5 actr actr NN 1 actr-i actr-us NNP 1 actr-ii actr-ius NNP 1 actress actress NN 440 actress actress NNP 27 actress actress JJ 3 actress actress UNC 2 actress-waitress actress-waitress JJ 2 actresses actress NNS 85 actresses actress NNP 2 actresses actresses UNC 3 actresss actresss NNS 1 actressy actressy NN 1 acts act NNS 607 acts act VBZ 88 acts act NNP 64 acts acts UNC 4 actttggatcattctatgcag actttggatcattctatgcag NNP 1 actu actu NN 1 actua actua NN 1 actual actual JJ 1935 actual actual NNP 9 actual actual UNC 2 actual actual NN 1 actual-vampire-seeing-and-slaying actual-vampire-seeing-and-slaying JJ 1 actuality actuality NN 9 actualize actualize NN 1 actualized actualized JJ 2 actually actually RB 9366 actually actually UNC 23 actually actually NNP 10 actually actually JJ 3 actually actually NN 2 actuallyl actuallyl NN 1 actuals actual NNS 1 actualy actualy RB 3 actualy actualy NNP 1 actuarial actuarial JJ 37 actuarial actuarial NNP 12 actuarial-based actuarial-based JJ 1 actuaries actuary NNS 19 actuaries actuary NNP 3 actuaristas actuarista NNS 2 actuary actuary NN 13 actuary actuary NNP 12 actuates actuate NNS 2 actuator actuator NN 6 actuators actuator NNS 1 actully actully RB 1 actus actus JJ 2 actwas actwa NNP 1 actwith actwith NN 2 actwu actwu UNC 1 acuesta acuesta NN 2 acuestén acuestén NN 1 acuff acuff NNP 1 acuity acuity NN 18 aculeatus aculeatus JJ 1 acumen acumen NN 29 acuolation acuolation NN 1 acupressure acupressure NN 2 acupuncture acupuncture NN 15 acupuncture acupuncture NNP 1 acupuncturist acupuncturist NN 1 acupuncturists acupuncturist NNS 2 acura acura NNP 11 acure acure NNP 1 acutally acutally NNP 4 acutally acutally RB 1 acute acute JJ 716 acute acute NNP 83 acute-care acute-care JJ 3 acute-phase acute-phase JJ 3 acutee acutee NN 1 acutely acutely RB 48 acutely acutely NNP 2 acuto acuto NNP 1 acuview acuview NNP 1 acuvue acuvue NNP 4 acuvue-vision acuvue-vision NNP 2 acuático acuático NNP 1 acuña acuña NNP 2 acv acv NNP 40 acv-resistant acv-resistant NNP 2 acv-susceptible acv-susceptible NNP 1 acvb acvb NNP 4 acvtivated acvtivated JJ 1 acyclic acyclic JJ 5 acyclovir acyclovir NN 3 acyclovir acyclovir NNP 2 acyl acyl NN 27 acyl acyl NNP 1 acyl-acyl acyl-acyl JJ 1 acyl-chain acyl-chain JJ 1 acyl-enzyme acyl-enzyme JJ 1 acylation acylation NN 1 acylcarnitine acylcarnitine NN 2 acylcarnitines acylcarnitine NNS 3 acylethanolamine acylethanolamine NN 2 acylethanolamines acylethanolamine NNS 1 acylglycerophospho-ethanolamine acylglycerophospho-ethanolamine JJ 1 acyltransferase acyltransferase NN 3 acyltransferases acyltransferase NNS 1 acyrthosiphon acyrthosiphon NNP 2 acá acá NNP 1 acánsa acánsa NNP 1 ad ad NN 1230 ad ad NNP 410 ad ad UNC 5 ad ad JJ 2 ad-adsx ad-adsx NNP 5 ad-based ad-based JJ 1 ad-busting ad-busting JJ 1 ad-column ad-column NNP 4 ad-daar ad-daar JJ 1 ad-driven ad-driven JJ 1 ad-e ad-e NNP 8 ad-exec ad-exec JJ 1 ad-free ad-free JJ 2 ad-git ad-git NNP 1 ad-hoc ad-hoc JJ 6 ad-in ad-in JJ 1 ad-laden ad-laden JJ 1 ad-lib ad-lib JJ 3 ad-libbed ad-libbed JJ 1 ad-libbing ad-libbing JJ 1 ad-libitum ad-libitum JJ 1 ad-libs ad-lib JJ 1 ad-m ad-m NNP 55 ad-maker ad-maker JJ 1 ad-makers ad-maker JJ 2 ad-nad ad-nad NNP 2 ad-prey ad-prey NNP 1 ad-revenue-sharing ad-revenue-sharing JJ 1 ad-sales ad-sale JJ 1 ad-serving ad-serving JJ 1 ad-skipping ad-skipping JJ 3 ad-snatchers ad-snatcher JJ 1 ad-supported ad-supported JJ 1 ad-tracking ad-tracking JJ 1 ad-transduced ad-transduced NNP 9 ad? ad? NN 1 ad?rvan ad?rvan NN 1 ada ada NNP 40 ada ada NN 1 adade adade NNP 1 adage adage NN 21 adages adage NNS 4 adagia adagium NNP 2 adagio adagio NN 1 adair adair NNP 5 adaja adaja NNP 1 adalar adalar NNP 1 adam adam NNP 428 adamance adamance NN 1 adamant adamant JJ 58 adamantium adamantium NNP 1 adamantly adamantly RB 17 adamao adamao NN 1 adame adame NNP 1 adament adament NN 1 adami adamus NNP 4 adamo adamo NNP 6 adamov adamov NNP 2 adams adam NNP 326 adams adams UNC 2 adams adams NNP 2 adamson adamson NNP 1 adamu adamu NNP 1 adana adana NNP 1 adao adao NNP 2 adapator adapator NN 1 adaped adaped JJ 1 adapt adapt VB 127 adapt adapt NNP 69 adapt adapt VBP 14 adaptability adaptability NN 13 adaptable adaptable JJ 23 adaptable adaptable NNP 2 adaptamer adaptamer NN 6 adaptamers adaptamer NNS 3 adaptation adaptation NN 234 adaptation adaptation NNP 9 adaptation-and adaptation-and NNP 1 adaptations adaptation NNS 64 adaptations adaptation NNP 5 adaptec adaptec NNP 1 adapted adapt VBN 209 adapted adapt VBD 35 adapted adapted UNC 3 adapted adapted NNP 2 adapter adapter NN 64 adapter adapter NNP 1 adapter-linked adapter-linked JJ 2 adapter-related adapter-related NNP 1 adapter-specific adapter-specific JJ 1 adapterized adapterized JJ 1 adapters adapter NNS 18 adapters adapter NNP 1 adapting adapt VBG 51 adapting adapting NNP 2 adapting adapting NN 1 adaption adaption NN 1 adaptive adaptive JJ 98 adaptive adaptive NNP 6 adaptiveha adaptiveha NN 3 adaptively adaptively RB 6 adaptivity adaptivity NN 1 adaptor adaptor NN 50 adaptor adaptor NNP 1 adaptor-amplified adaptor-amplified JJ 1 adaptor-ligated adaptor-ligated JJ 1 adaptor-specific adaptor-specific JJ 1 adaptors adaptor NNS 24 adapts adapt NNS 11 adar adar NNP 4 adas ada NNP 1 adas-cog adas-cog NNP 31 adas? adas? NN 8 adas? adas? NNP 1 adata ada NN 2 aday aday NNP 1 adb adb NNP 2 adblock adblock NN 1 adbul adbul NNP 1 adbusters adbuster NNP 1 adc adc NNP 4 adcaps adcap NNP 4 adcc adcc NNP 2 adcell adcell NNP 1 adco adco NNP 1 adcock adcock NNP 4 adcose adcose NN 1 add add VB 1484 add add VBP 274 add add NNP 18 add add UNC 4 add add NN 2 add-a-bead add-a-bead JJ 1 add-in add-in JJ 1 add-on add-on JJ 23 add-ons add-on JJ 4 addaia addaium NNP 1 addams addam NNP 25 addario addario NNP 2 adddecorations adddecoration NNP 1 added add VBD 1683 added add VBN 1456 added added JJ 40 added added NNP 4 added added UNC 3 added-soul added-soul JJ 1 addeled addeled JJ 1 addend addend NNP 2 addenda addendum NN 11 addenda addendum NNP 10 addends addend NNS 2 addendum addendum NN 14 addendum addendum NNP 5 addendums addendum NNS 1 adder adder NNP 7 adderal adderal NNP 1 adderall adderall NNP 1 adderley adderley NNP 1 addhighlights addhighlight NNP 1 addicated addicated JJ 1 addicition addicition NN 1 addict addict NN 62 addict addict NNP 9 addict addict UNC 1 addicted addict VBN 122 addicted addicted NNP 14 addicted addicted JJ 1 addicting addict VBG 5 addiction addiction NN 187 addiction addiction NNP 24 addiction addiction UNC 1 addiction-related addiction-related JJ 1 addictions addiction NNS 24 addictions addiction NNP 1 addictions addictions UNC 2 addictive addictive JJ 85 addictive addictive NNP 2 addictive addictive UNC 1 addictiveness addictiveness NNS 2 addicts addict NNS 64 addicts addict NNP 3 addicts addicts UNC 2 addie addie NNP 2 addie addie NN 1 addies addy NNS 1 adding add VBG 959 adding adding UNC 3 adding adding NNP 1 adding adding NN 1 addington addington NNP 1 addison addison NNP 45 addition addition NN 3722 addition addition NNP 44 additional additional JJ 4298 additional additional NNP 15 additionally additionally RB 395 additionaly additionaly RB 2 additionnal additionnal NN 1 additions addition NNS 87 additions addition NNP 4 additive additive JJ 129 additive additive NNP 2 additive-plus-multiplicative additive-plus-multiplicative JJ 1 additively additively RB 7 additives additive NNS 30 additives additive NNP 9 additivity additivity NN 6 additized additized JJ 1 additon additon NN 1 additonal additonal NN 12 addization addization NN 1 addizione addizione NNP 1 addi­tional addi­tional NNP 1 addle addle NN 1 addle-brained addle-brained JJ 1 addled addled JJ 24 addlepated addlepated JJ 4 addlistener addlistener NN 1 addo addo NNP 22 addopark addopark NN 1 address address VB 1121 address address NN 1067 address address NNP 368 address address VBP 115 address address UNC 6 address address JJ 1 address-book address-book JJ 1 address-change address-change JJ 1 addressable addressable JJ 2 addressc addressc NNP 1 addressed address VBN 468 addressed address VBD 148 addressed addressed NNP 12 addressed addressed UNC 5 addressee addressee NN 2 addressee addressee NNP 1 addressees addressee NNS 2 addresses address NNS 244 addresses address VBZ 121 addresses address NNP 13 addresses-one addresses-one JJ 1 addressin addressin NN 6 addressinformation addressinformation NN 1 addressing address VBG 336 addressing addressing UNC 2 addressing addressing NNP 1 addressins addressin NNS 2 addresss addresss NNS 1 addrln addrln NNP 1 adds add VBZ 654 adds add NNP 7 adds adds UNC 2 addsol addsol NNP 1 addtodesignreview addtodesignreview NNP 1 adduce adduce NN 2 adduced adduced JJ 10 adduces adduce NNS 4 adducing adduce VBG 4 adducins adducin NNS 1 adduct adduct NN 10 adducted adducted JJ 1 adducting adduct VBG 1 adductor adductor NN 1 adducts adduct NNS 23 adduxerunt adduxerunt NN 1 addy addy NN 54 addy addy NNP 2 ade ade NN 28 ade ade NNP 22 adeasy adeasy NNP 2 adecco adecco NNP 2 adecrease adecrease NN 1 adega adega NNP 2 adegas adega NNP 2 adeje adeje NNP 2 adel adel NNP 1 adelaide adelaide NNP 13 adelantado adelantado NNP 1 adele adele NNP 21 adeliae adelia NN 1 adelie adelie NNP 1 adelina adelina NNP 2 adelita adelita NNP 18 adelitas adelita NNP 3 adelman adelman NNP 3 adelphia adelphium NNP 69 adelson adelson NNP 1 adelstein adelstein NNP 2 adema adema NNP 2 ademonstrates ademonstrate NNS 3 aden aden NNP 16 adena adena NNP 12 adenauer adenauer NNP 1 adenine adenine NN 30 adenine adenine NNP 2 adenine-labeled adenine-labeled JJ 1 adenine-like adenine-like JJ 1 adenine-requiring adenine-requiring JJ 2 adenines adenine NNS 7 adeno adeno NN 17 adeno adeno NNP 2 adeno-? adeno-? JJ 2 adeno-?gal adeno-?gal JJ 3 adeno-?gal adeno-?gal NNP 2 adeno-associated adeno-associated JJ 1 adenocarcinoma adenocarcinoma NN 45 adenocarcinomas adenocarcinoma NNS 26 adenoidal adenoidal NN 2 adenoids adenoids NNS 1 adenoma adenoma NN 29 adenomas adenoma NNS 16 adenomas adenoma NNP 1 adenomatous adenomatous JJ 7 adenomatous adenomatous NNP 1 adenosine adenosine NN 51 adenosine adenosine NNP 1 adenosine-binding adenosine-binding JJ 1 adenosines adenosine NNS 12 adenosinetriphosphatase adenosinetriphosphatase NN 1 adenosis adenosis NNS 1 adenosylhomocysteine adenosylhomocysteine NN 2 adenosylmethionine adenosylmethionine NN 3 adenoviral adenoviral NN 167 adenoviral adenoviral NNP 15 adenoviral-mediated adenoviral-mediated JJ 5 adenoviral-mediated adenoviral-mediated NNP 1 adenoviral-resistant adenoviral-resistant JJ 1 adenovirally adenovirally RB 2 adenovirus adenovirus JJ 82 adenovirus adenovirus NNP 5 adenovirus adenovirus NN 1 adenovirus-based adenovirus-based JJ 1 adenovirus-infected adenovirus-infected JJ 1 adenovirus-mediated adenovirus-mediated JJ 11 adenovirus-microbead adenovirus-microbead JJ 4 adenoviruses adenovirus NNS 11 adenoviruses adenovirus NNP 2 adenylate adenylate NN 16 adenylate-uridylate-rich adenylate-uridylate-rich NNP 1 adenylated adenylated JJ 2 adenylates adenylate NNS 2 adenylation adenylation NN 5 adenyly adenyly RB 1 adenylyl adenylyl NN 35 adenylyl adenylyl NNP 1 adenylylated adenylylated JJ 4 adeo adeo NN 1 adepicts adepict NNS 4 adepicts adepict NNP 3 adept adept JJ 69 adept adept NNP 8 adeptly adeptly RB 3 adeptness adeptness NNS 1 adepts adept NNS 1 adequacy adequacy NN 42 adequacy adequacy NNP 3 adequate adequate JJ 483 adequate adequate NNP 13 adequate-to-great adequate-to-great JJ 1 adequately adequately RB 221 adequately adequately NNP 2 adescription adescription NN 1 adeshem adeshem NN 1 adesktop adesktop NN 1 adeus adeus NNP 2 adf adf NNP 2 adflugasdemo adflugasdemo NN 1 adge adge NNP 63 adgemicroarray adgemicroarray NNP 1 adger adger NNP 2 adh adh NNP 31 adh adh NN 1 adh-f adh-f NNP 1 adh-r adh-r NNP 1 adha adha NNP 1 adhd adhd NNP 114 adhd-obesity adhd-obesity NNP 1 adherants adherant NNS 1 adhere adhere VB 96 adhered adhere VBD 29 adherence adherence NN 123 adherence adherence NNP 4 adherens adheren NNS 2 adherent adherent NN 105 adherent adherent NNP 11 adherents adherent NNS 32 adherents adherent NNP 1 adheres adhere NNS 13 adherin adherin NN 1 adhering adhere VBG 28 adhering adhering NNP 1 adhesin adhesin NN 3 adhesins adhesin NNS 2 adhesion adhesion NN 272 adhesion adhesion NNP 15 adhesion-related adhesion-related JJ 1 adhesions adhesion NNS 7 adhesive adhesive NN 65 adhesiveness adhesiveness NNS 2 adhesives adhesive NNS 2 adhoc adhoc NN 4 adhoccery adhoccery NN 2 adhocist adhocist NN 1 adhr adhr NNP 1 adhregion adhregion NNP 1 adhuc adhuc NN 1 adhumbla adhumblum NNP 2 adi adus NNP 68 adiabatic adiabatic JJ 2 adiabne adiabne NNP 1 adiantaceae adiantacea NNP 2 adiantum adiantum NNP 2 adidas adida NNP 15 adieu adieu NN 13 adieu adieu NNP 6 adieus adieus JJ 1 adieux adieu NN 1 adifferent adifferent NNP 1 adifferent adifferent NN 1 adige adige NNP 6 adiii adiius NNP 2 adil adil NNP 5 adin adin NNP 3 adina adina NNP 3 adinath adinath NNP 3 adinspection adinspection NNP 1 adioh adioh NN 1 adios adio NNS 6 adios adio NNP 4 adipic adipic JJ 1 adipocyte adipocyte NN 11 adipocyte-derived adipocyte-derived JJ 1 adipocytes adipocyte NNS 26 adipocytic adipocytic JJ 2 adipocytic adipocytic NNP 2 adipogenesis adipogenesis NNS 2 adipogenic adipogenic JJ 2 adiponectin adiponectin NN 10 adiponectin adiponectin NNP 2 adipose adipose NN 27 adiposity adiposity NN 19 adirondack adirondack NNP 15 adirondack adirondack NN 2 adirondacks adirondack NNP 14 adirondacks adirondack NNS 2 adis adi NNP 9 adisease-detection adisease-detection JJ 1 aditional aditional NN 3 adivinanzas adivinanza NNP 3 adiyaman adiyaman NNP 1 adiós adiós NNS 1 adj adj NN 47 adj adj NNP 6 adjacencies adjacency NNS 2 adjacency adjacency NN 1 adjacent adjacent JJ 628 adjacent adjacent NNP 39 adjacenting adjacent VBG 1 adjacently adjacently RB 1 adjangba adjangba NNP 1 adjani adjanus NNP 2 adjectival adjectival NN 12 adjectivally adjectivally RB 4 adjective adjective NN 123 adjective adjective NNP 5 adjective-abuser adjective-abuser JJ 1 adjective-names adjective-name JJ 1 adjectives adjective NNS 84 adjectives adjective NNP 9 adjectivewise adjectivewise NN 1 adjectivising adjectivise VBG 2 adjoin adjoin NN 2 adjoined adjoined JJ 2 adjoining adjoining JJ 94 adjoining adjoining NNP 10 adjoins adjoin NNS 12 adjourn adjourn NN 14 adjourned adjourn VBN 11 adjourning adjourn VBG 3 adjournment adjournment NN 5 adjourns adjourn NNS 6 adjourns adjourn NNP 1 adjrun adjrun NN 1 adjudged adjudged JJ 3 adjudges adjudge NNS 1 adjudicate adjudicate NN 13 adjudicate adjudicate NNP 1 adjudicated adjudicated JJ 30 adjudicates adjudicate NNS 3 adjudicating adjudicate VBG 2 adjudication adjudication NN 29 adjudication adjudication NNP 2 adjudicative adjudicative JJ 4 adjudicator adjudicator NN 4 adjudicatory adjudicatory NN 3 adjudicatory adjudicatory NNP 1 adjunct adjunct NN 36 adjunct adjunct NNP 2 adjunctive adjunctive JJ 1 adjuncts adjunct NNS 4 adjuncts adjunct NNP 1 adjured adjured JJ 1 adjurn adjurn NN 1 adjust adjust VB 243 adjust adjust VBP 40 adjustability adjustability NN 2 adjustable adjustable JJ 57 adjustable adjustable NNP 2 adjusted adjust VBN 527 adjusted adjust VBD 80 adjusted adjusted NNP 16 adjusted adjusted JJ 3 adjusted adjusted UNC 1 adjusted-rates adjusted-rate JJ 1 adjuster adjuster NN 8 adjuster adjuster NNP 1 adjusters adjuster NNS 5 adjusting adjust VBG 159 adjusting adjusting NNP 11 adjusting adjusting NN 8 adjustment adjustment NN 310 adjustment adjustment NNP 24 adjustments adjustment NNS 174 adjustments adjustment NNP 13 adjustn adjustn NN 2 adjusts adjust VBZ 39 adjusts adjust NNP 1 adjustvar adjustvar NN 2 adjutant adjutant NN 3 adjuvant adjuvant NN 66 adjuvant adjuvant NNP 4 adjuvant-induced adjuvant-induced JJ 2 adjuvants adjuvant NNS 5 adkins adkin NNP 34 adl adl NNP 6 adlai adlaus NNP 15 adler adler NNP 43 adlestrop adlestrop NNP 11 adlestrop adlestrop UNC 1 adleta adleta NNP 1 adlon adlon NNP 1 adlum adlum NNP 2 adm adm NNP 28 admaker admaker NN 1 admakers admaker NNS 1 adman adman NN 7 adman adman NNP 1 adme adme NNP 4 admen adman NNS 1 admen adman NNP 1 admin admin NN 21 admin admin NNP 6 administaff administaff NN 1 administer administer VB 96 administer administer NNP 1 administered administer VBN 331 administered administered NNP 5 administering administer VBG 66 administering administering NNP 3 administers administer VBZ 38 administrate administrate NN 4 administrated administrated JJ 2 administrating administrate VBG 3 administration administration NN 2691 administration administration NNP 713 administration administration UNC 7 administration administration JJ 1 administration-sponsored administration-sponsored NNP 1 administrationn administrationn NNP 1 administrations administration NNS 80 administrations administration NNP 4 administrative administrative JJ 367 administrative administrative NNP 117 administrative-type administrative-type JJ 1 administratively administratively RB 13 administrator administrator NNP 479 administrator administrator NN 143 administrator administrator UNC 1 administratorand administratorand NNP 1 administrators administrator NNS 166 administrators administrator NNPS 15 administrators administrators UNC 1 administratorshall administratorshall NNP 4 administrivia administrivium NN 2 administrtation administrtation NN 1 admins admin NNS 5 adminster adminster NN 1 adminstration adminstration NNP 1 adminstration adminstration NN 1 adminstrator adminstrator NN 1 adminwise adminwise NN 1 adminy adminy NN 1 admirable admirable JJ 110 admirable admirable NNP 4 admirable admirable UNC 2 admirably admirably RB 42 admirably admirably NNP 2 admiral admiral NN 34 admiral admiral NNP 34 admirals admiral NNS 5 admirals admiral NNP 2 admiralty admiralty NNP 4 admiralty admiralty NN 1 admirans admiran NNS 1 admirari admirarus NN 1 admiration admiration NN 107 admire admire NN 217 admire admire NNP 2 admire admire UNC 1 admired admire VBN 107 admired admire VBD 45 admired admired UNC 2 admired admired NNP 1 admirer admirer NN 20 admirers admirer NNS 55 admires admire VBZ 21 admiring admire VBG 63 admiring admiring NNP 2 admiringly admiringly RB 10 admir­able admir­able JJ 1 admissibility admissibility NN 8 admissibility admissibility NNP 5 admissible admissible JJ 13 admission admission NN 498 admission admission NNP 36 admission admission UNC 2 admissions admission NNS 302 admissions admission NNP 25 admissions admissions UNC 3 admissions admissions NN 1 admissionsall admissionsall NNP 1 admisssions admisssion NNS 1 admist admist NNP 1 admit admit VB 601 admit admit VBP 203 admit admit NNP 12 admit admit JJ 2 admit admit UNC 1 admitedly admitedly RB 1 admitprecisely admitprecisely RB 1 admits admit VBZ 249 admits admit NNP 8 admits admit NNS 3 admits admits UNC 3 admittance admittance NN 5 admittance admittance NNP 1 admitted admit VBN 402 admitted admit VBD 238 admitted admitted UNC 3 admitted admitted NNP 2 admittedly admittedly RB 167 admittedly admittedly UNC 2 admittedpostoperatively admittedpostoperatively RB 1 admittedto admittedto NN 1 admittees admittee NNS 1 admitting admit VBG 136 admitting admitting NNP 8 admixed admixed JJ 1 admixture admixture NN 11 admixture admixture NNP 1 admixtures admixture NNS 2 admnistration admnistration NN 1 admonish admonish NN 6 admonished admonished JJ 22 admonishes admonish NNS 7 admonishes admonish NNP 1 admonishing admonish VBG 4 admonishment admonishment NN 2 admonition admonition NN 22 admonition admonition JJ 1 admonitione admonitione NN 1 admonitions admonition NNS 8 admonitor admonitor NN 1 admonitory admonitory NN 4 adn adn NN 10 adn adn NNP 1 adna adna NN 21 adnan adnan NNP 9 adnd adnd NNP 2 ado ado NN 9 ado ado NNP 6 adobe adobe NNP 67 adobe adobe NN 33 adobepdf adobepdf NN 1 adoberas adobera NNS 1 adobo adobo NN 1 adobo adobo NNP 1 adoke adoke NNP 1 adol adol NNP 5 adolesc adolesc NNP 3 adolescence adolescence NN 75 adolescence adolescence NNP 3 adolescence adolescence UNC 2 adolescencia adolescencium NNP 1 adolescent adolescent JJ 119 adolescent adolescent NN 19 adolescent adolescent NNP 2 adolescent adolescent UNC 1 adolescent-adventure adolescent-adventure JJ 1 adolescent-angsty adolescent-angsty JJ 1 adolescent-use adolescent-use JJ 1 adolescents adolescent NNS 109 adolescents adolescent NNP 10 adolescents-at-heart adolescents-at-heart JJ 1 adolesence adolesence NN 1 adolf adolf NNP 51 adolfo adolfo NNP 4 adolph adolph NNP 12 adolphe adolphe NNP 3 adolsecent adolsecent NN 1 adomet adomet NNP 5 adonais adonai NNP 1 adonay adonay NN 1 adone adone NN 1 adone adone NNP 1 adonis adoni NNP 5 adonitol adonitol NN 1 adopt adopt VB 262 adopt adopt VBP 44 adopt adopt NNP 8 adopt adopt NN 1 adopt-a adopt-a NNP 1 adoptable adoptable NNP 1 adopted adopt VBN 495 adopted adopt VBD 209 adopted adopted NNP 4 adopted adopted UNC 2 adopted-to adopted-to JJ 1 adoptee adoptee NN 1 adoptees adoptee NNS 3 adopter adopter NN 3 adopters adopter NNS 8 adopting adopt VBG 135 adoption adoption NN 189 adoption adoption NNP 10 adoption-related adoption-related JJ 2 adoptions adoption NNS 11 adoptive adoptive JJ 46 adoptive adoptive NNP 6 adoptively adoptively RB 7 adoptively-transferred adoptively-transferred JJ 1 adopts adopt VBZ 48 adopts adopt NNP 2 adopts adopts UNC 1 adoquín adoquín NNP 1 adora adora NNP 2 adorability adorability NN 3 adorable adorable JJ 156 adorable adorable NNP 12 adorable adorable UNC 1 adorableness adorableness NNS 5 adorableness adorableness NNP 1 adorably adorably RB 2 adorably adorably UNC 1 adorably adorably NNP 1 adoran adoran NN 1 adoration adoration NN 18 adoration adoration NNP 10 adorations adoration NNS 1 adorble adorble JJ 1 adore adore NN 129 adore adore NNP 8 adored adored JJ 62 adored adored NNP 6 adores adore NNS 21 adoring adore VBG 30 adoring adoring NNP 2 adoringly adoringly RB 2 adorn adorn VB 38 adorned adorn VBD 22 adorned adorn VBN 12 adorned adorned NNP 3 adorning adorn VBG 7 adornment adornment NN 4 adornment adornment NNP 1 adornments adornment NNS 6 adorno adorno NNP 10 adorns adorn NNS 13 adowe adowe NNP 1 adp adp NNP 49 adp-glucose adp-glucose NNP 1 adp-ribose adp-ribose NNP 1 adp-ribosylates adp-ribosylate NNP 1 adp-ribosylation adp-ribosylation NNP 14 adpase adpase NNP 4 adpated adpated JJ 1 adpativeh adpativeh NN 4 adpnp adpnp NNP 9 adprt adprt NNP 3 adr adr NNP 71 adr adr NN 1 adr-res adr-re NNP 2 adr-sensitive adr-sensitive NNP 1 adra adra NNP 2 adrelevance adrelevance NNP 3 adrenal adrenal NN 60 adrenal adrenal NNP 2 adrenalectomized adrenalectomized JJ 25 adrenalectomized adrenalectomized NN 1 adrenalectomized-streptozotocin-injected-ad adrenalectomized-streptozotocin-injected-ad JJ 1 adrenalectomized-streptozotocin-injected-fasted adrenalectomized-streptozotocin-injected-fasted JJ 1 adrenalectomy adrenalectomy NN 87 adrenalectomy adrenalectomy NNP 13 adrenalin adrenalin NN 12 adrenaline adrenaline NN 27 adrenaline adrenaline NNP 1 adrenaline-happy adrenaline-happy JJ 1 adrenaline-induced adrenaline-induced JJ 1 adrenaline-pumping adrenaline-pumping JJ 1 adrenaline-rush adrenaline-rush JJ 1 adrenaline-soaked adrenaline-soaked JJ 1 adrenaline-swamped adrenaline-swamped JJ 1 adrenals adrenal NNS 1 adrenergic adrenergic JJ 57 adrenergic-receptor adrenergic-receptor JJ 1 adrenergic-renin-angiotensin adrenergic-renin-angiotensin JJ 1 adrenergicand adrenergicand NN 1 adrenoceptor adrenoceptor NN 2 adrenocortical adrenocortical JJ 3 adrenocorticotrophic adrenocorticotrophic JJ 1 adrenocorticotrophin adrenocorticotrophin NN 2 adrenocorticotropic adrenocorticotropic JJ 2 adrenoreceptor adrenoreceptor NN 1 adressing adress VBG 2 adriaen adriaen NNP 3 adriaensz adriaensz NNP 1 adriamycin adriamycin NNP 3 adriamycin adriamycin NN 2 adrian adrian NNP 63 adriana adriana NNP 6 adriane adriane NNP 1 adrianne adrianne NNP 3 adriano adriano NNP 1 adrianople adrianople NNP 2 adrianou adrianou NNP 6 adrian­ople adrian­ople NNP 1 adriatic adriatic NNP 20 adrien adrien NNP 13 adrienne adrienne NNP 8 adrift adrift NN 27 adrift adrift NNP 1 adroit adroit JJ 8 adroitly adroitly RB 14 ads ad NNS 813 ads ad NNPS 10 ads ad NNP 8 ads ad NN 3 ads ads UNC 7 ads ads JJ 2 ads-no ads-no JJ 1 adscendit adscendit NN 2 adsiduos adsiduo NNS 1 adsl adsl NNP 4 adsorb adsorb NN 2 adsorbed adsorbed JJ 15 adsorbent adsorbent NN 1 adsorption adsorption NN 27 adsp adsp NN 1 adsubtract adsubtract NNP 2 adsurdity adsurdity NN 1 adsx adsx NNP 20 adsx-nad adsx-nad NNP 1 adu adu NNP 1 aduana aduana NNP 3 adubato adubato NNP 4 adulation adulation NN 13 adulation adulation NNP 1 adulatory adulatory NN 8 adult adult NN 1360 adult adult NNP 105 adult adult JJ 15 adult adult UNC 2 adult-acting adult-acting JJ 1 adult-book adult-book JJ 1 adult-care adult-care NNP 1 adult-child adult-child JJ 3 adult-development adult-development JJ 1 adult-directed adult-directed JJ 1 adult-emergence adult-emergence JJ 1 adult-film adult-film JJ 1 adult-flavored adult-flavored JJ 1 adult-free adult-free JJ 1 adult-imposed adult-imposed JJ 1 adult-incest adult-incest JJ 1 adult-like adult-like JJ 1 adult-onset adult-onset JJ 3 adult-organized adult-organized JJ 1 adult-oriented adult-oriented JJ 5 adult-quality adult-quality JJ 1 adult-relationship adult-relationship JJ 1 adult-specific adult-specific JJ 1 adult-structured adult-structured JJ 1 adult-supervised adult-supervised JJ 1 adult-supremacy adult-supremacy JJ 1 adult-themed adult-themed JJ 1 adulterant adulterant NN 1 adulterated adulterated JJ 1 adulterating adulterate VBG 2 adulteration adulteration NN 1 adulterator adulterator NN 1 adulterer adulterer NN 13 adulterer adulterer UNC 1 adulterers adulterer NNS 8 adulterers adulterer NNP 1 adulteress adulteress NNS 2 adulterous adulterous JJ 34 adultery adultery NN 128 adultery adultery NNP 33 adultery adultery UNC 5 adulthood adulthood NN 121 adulthood adulthood UNC 2 adulthood adulthood NNP 1 adultiness adultiness NNS 1 adultless adultless JJ 1 adults adult NNS 1051 adults adult NNP 3 adults adults UNC 6 adults-only adults-only JJ 5 adulty adulty NN 2 adult– adult– NNP 3 adult– adult– NN 1 adult–child adult–child NN 29 adult–child adult–child NNP 1 adulyadeh adulyadeh NNP 1 adumbrated adumbrated JJ 4 adumbrations adumbration NNS 3 adumim adumim NNP 1 aduncity aduncity NN 1 adup adup NNP 4 adur adur NNP 1 adurt adurt NNP 1 adustion adustion NN 1 aduuka aduuka NN 1 adv adv NNP 103 adv-t adv-t NNP 1 advance advance NN 622 advance advance VB 150 advance advance NNP 51 advance advance VBP 16 advance advance UNC 5 advance-purchase advance-purchase JJ 3 advance-royalty advance-royalty JJ 1 advanced advance VBD 295 advanced advance VBN 230 advanced advanced NNP 112 advanced advanced JJ 75 advanced-country advanced-country JJ 1 advanced-placement advanced-placement JJ 1 advanced-stage advanced-stage JJ 1 advancement advancement NN 59 advancement advancement NNP 26 advancements advancement NNS 21 advancepcs advancepc NNP 1 advances advance NNS 298 advances advance NNP 5 advances advances UNC 1 advances advances JJ 1 advancing advance VBG 118 advancing advancing NNP 1 advanta advanta NNP 1 advantage advantage NN 1305 advantage advantage NNP 34 advantage advantage UNC 4 advantage advantage VB 2 advantage-we advantage-we JJ 1 advantaged advantaged JJ 9 advantageous advantageous JJ 69 advantageously advantageously RB 4 advantages advantage NNS 358 advantages advantage NNP 21 advantages advantages UNC 4 advective advective JJ 1 advenissent advenissent NN 1 advent advent NN 147 advent advent NNP 8 adventis adventi NNP 1 adventist adventist NNP 4 adventists adventist NNP 2 adventitia adventitium NN 11 adventitial adventitial NN 1 adventitious adventitious JJ 1 advents advent NNP 1 adventure adventure NN 243 adventure adventure NNP 40 adventure adventure UNC 2 adventure-drama adventure-drama JJ 1 adventure-tourism adventure-tourism JJ 1 adventured adventured JJ 1 adventureland adventureland NNP 3 adventurer adventurer NN 18 adventurer adventurer NNP 1 adventurers adventurer NNS 18 adventurers adventurer NNP 3 adventures adventure NNS 124 adventures adventure NNP 57 adventuresome adventuresome NN 8 adventuring adventure VBG 3 adventurism adventurism NN 6 adventurous adventurous JJ 79 adventurous adventurous NNP 2 adventurously adventurously RB 1 adver adver NN 1 adverb adverb NN 29 adverb adverb NNP 2 adverb-adjective adverb-adjective JJ 1 adverbial adverbial NN 3 adverbial adverbial NNP 2 adverbially adverbially RB 1 adverbs adverb NNS 27 adversarial adversarial JJ 20 adversaries adversary NNS 43 adversary adversary NN 33 adversary adversary UNC 1 adversary adversary NNP 1 adverse adverse JJ 437 adversely adversely RB 55 adversities adversity NNS 1 adversity adversity NN 37 adversity adversity NNP 3 adversitycakes adversitycake NNS 1 advert advert NN 1 adverting advert VBG 1 advertise advertise VB 77 advertise advertise VBP 35 advertised advertise VBN 102 advertised advertise VBD 34 advertised advertised UNC 1 advertised advertised NNP 1 advertisement advertisement NN 122 advertisement advertisement JJ 1 advertisement-free advertisement-free JJ 1 advertisementb advertisementb NN 1 advertisements advertisement NNS 126 advertisements advertisement NNP 4 advertisements advertisements UNC 1 advertiser advertiser NN 18 advertiser advertiser NNP 2 advertisers advertiser NNS 173 advertisers advertiser NNPS 1 advertisers advertisers UNC 3 advertises advertise VBZ 15 advertising advertise VBG 63 advertising advertising NN 821 advertising advertising NNP 63 advertising advertising UNC 7 advertising-based advertising-based JJ 1 advertising-copywriter-cum-pope advertising-copywriter-cum-pope JJ 1 advertising-driven advertising-driven JJ 1 advertising-supported advertising-supported JJ 2 advertisser advertisser NNP 1 advertizing advertize VBG 1 advertorial advertorial JJ 5 advertorials advertorial NNS 4 advertrise advertrise NN 1 adverts advert NNP 1 advi advi NN 1 advice advice NN 1066 advice advice NNP 46 advice advice UNC 7 advice-giving advice-giving JJ 1 advice-hounds advice-hound JJ 1 advice-seeker advice-seeker JJ 1 advices advice NNP 2 advil advil NNP 8 advil advil NN 2 advino advino NNP 1 adviosed adviosed JJ 1 advis advis NNP 1 advisability advisability NN 4 advisable advisable JJ 55 advise advise VB 154 advise advise VBP 29 advise advise UNC 1 advise advise NNP 1 advised advise VBD 162 advised advise VBN 146 advised advised NNP 1 advisedly advisedly RB 2 advisement advisement NN 2 adviser adviser NN 258 adviser adviser NNP 38 adviser adviser UNC 1 advisers adviser NNS 240 advisers adviser NNPS 22 advisers adviser NNP 5 advisers advisers UNC 1 advises advise VBZ 107 advising advise VBG 87 advising advising NNP 5 advising advising NN 3 advisings advising NNS 1 advisor advisor NN 118 advisor advisor NNP 38 advisories advisory NNS 30 advisories advisory NNP 1 advisors advisor NNS 121 advisors advisor NNP 25 advisors advisors UNC 1 advisory advisory JJ 151 advisory advisory NNP 110 advisory advisory NN 7 advocacy advocacy NN 198 advocacy advocacy NNP 46 advocate advocate NN 197 advocate advocate VB 46 advocate advocate NNP 36 advocate advocate VBP 34 advocate advocate UNC 1 advocate-expressed advocate-expressed NNP 1 advocated advocate VBN 48 advocated advocate VBD 45 advocates advocate NNS 412 advocates advocate VBZ 28 advocates advocate NNP 1 advocates advocates UNC 2 advocating advocate VBG 82 advocating advocating NNP 3 advoctaes advoctae NNS 1 advokaat advokaat NNP 2 advt advt NNP 1 adwan adwan NNP 26 adwatch adwatch NNP 1 adweek adweek NNP 2 adx-stz adx-stz NNP 3 adx-stz-fast adx-stz-fast NNP 4 adygea adygea NNP 1 adze adze NN 1 adzuki adzukus NN 1 ad­­vanced ad­­vanced JJ 1 adán adán NNP 1 adèle adèle NNP 1 adélie adélie NNP 3 adélies adélies NNP 4 ae ae NNP 81 ae ae NN 8 ae ae UNC 1 aea aea NNP 4 aeaea aeaea NNP 1 aebersole aebersole NNP 1 aebi aebus NNP 1 aebsf aebsf NNP 1 aec aec NNP 15 aecer aecer NN 1 aecom aecom NN 5 aecom aecom NNP 1 aect aect NN 7 aected aected JJ 5 aecting aect VBG 5 aection aection NN 4 aection aection UNC 1 aectionate aectionate NN 2 aects aect NNS 6 aedes aede NNP 3 aedicule aedicule NN 1 aeegintrs aeegintr NNP 1 aeesome aeesome NNP 1 aeg aeg NNP 6 aegean aegean NNP 109 aegina aegina NNP 4 aegis aegis NN 6 aegis aegis NNP 1 aegon aegon NNP 1 aegypti aegyptus NN 1 aehy aehy NNP 1 aei aeus NNP 7 aek aek NNP 1 ael ael NN 1 aelfric aelfric NNP 4 aelfwine aelfwine NNP 3 aelia aelium NNP 3 aeneid aeneid NNP 4 aeneus aeneus JJ 1 aenlle aenlle NNP 1 aeo aeo NNP 19 aeolians aeolian NNP 1 aeolicus aeolicus JJ 17 aeon aeon NN 2 aeon aeon NNP 2 aeons aeon NNS 1 aeons aeon NNP 1 aep aep NNP 4 aer aer NNP 7 aer-a aer-a NNP 1 aer-d aer-d NNP 2 aerate aerate NNP 7 aerate aerate NN 3 aerated aerated JJ 16 aeration aeration NN 23 aeration aeration NNP 11 aerial aerial JJ 58 aerial aerial NNP 11 aerialist aerialist NN 1 aerially aerially RB 2 aerials aerial NNS 1 aerie aerie NN 5 aeries aerie NNS 1 aerio aerio NNP 1 aero aero NNP 10 aero aero NN 2 aero-engine aero-engine JJ 2 aerobatics aerobatics NNS 1 aerobed aerobed NNP 2 aerobes aerobe NNS 1 aerobic aerobic JJ 80 aerobic aerobic NNP 9 aerobic-type aerobic-type JJ 1 aerobically aerobically RB 4 aerobicise aerobicise NN 1 aerobics aerobic NN 157 aerobics aerobic NNP 4 aerodigestive aerodigestive JJ 3 aerodium aerodium NNP 1 aerodrome aerodrome NNP 3 aerodynamic aerodynamic JJ 12 aerodynamics aerodynamics NNS 7 aerodyne aerodyne NNP 1 aerogenes aerogene NNS 2 aeromax aeromax NNP 1 aerometric aerometric NNP 1 aeromonas aeromona NNP 9 aeromousse aeromousse NNP 1 aeronautic aeronautic NNP 3 aeronautic aeronautic JJ 1 aeronautical aeronautical JJ 16 aeronautical aeronautical NNP 8 aeronautics aeronautics NNP 16 aeronautics aeronautics NNS 4 aeroperu aeroperu NNP 1 aerophilum aerophilum NN 3 aeroplane aeroplane NNP 2 aeroplane aeroplane NN 1 aeroplane aeroplane UNC 1 aeroporto aeroporto NNP 1 aeropyrum aeropyrum NNP 9 aeros aero NNP 1 aerosmith aerosmith NNP 28 aerosol aerosol NN 56 aerosol aerosol NNP 3 aerosoles aerosole NNP 9 aerosolization aerosolization NN 6 aerosolization aerosolization NNP 1 aerosolized aerosolized JJ 8 aerosols aerosol NNS 13 aerosols aerosol NNP 9 aerospace aerospace NN 51 aerospace aerospace NNP 15 aerospatiale aerospatiale NNP 1 aerostar aerostar NNP 1 aerpe aerpe NNP 1 aertoercken aertoercken NN 1 aerts aert NNP 14 aeruginos aerugino NNS 1 aeruginosa aeruginosa NN 145 aeruginosaand aeruginosaand NN 1 aeruginosaperiplasm aeruginosaperiplasm NN 2 aerugionsa aerugionsa NN 1 aeryn aeryn NNP 7 aeryn-oost aeryn-oost NNP 1 aes ae NNP 10 aes-drafted aes-drafted NNP 1 aeschbacher aeschbacher NNP 1 aeschylus aeschylus NNP 3 aesculap aesculap NNP 1 aeshma aeshma NNP 7 aesop aesop NNP 8 aesopian aesopian NNP 1 aestheic aestheic JJ 1 aesthete aesthete NN 8 aesthete-mystic aesthete-mystic JJ 1 aesthetes aesthete NNS 1 aesthetic aesthetic JJ 174 aesthetic aesthetic NN 30 aesthetic aesthetic NNP 10 aesthetic aesthetic UNC 2 aesthetically aesthetically RB 20 aesthetically aesthetically NNP 1 aestheticienne aestheticienne NN 1 aestheticism aestheticism NN 2 aestheticism aestheticism NNP 1 aestheticizing aestheticize VBG 4 aesthetics aesthetics NNS 48 aesthetics aesthetics NNP 4 aesthetics aesthetics UNC 1 aestivum aestivum NN 2 aeterna aeterna NNP 1 aetheistic aetheistic JJ 1 aether aether NN 1 aethiopis aethiopi NNS 1 aetiological aetiological JJ 1 aetiology aetiology NN 7 aetna aetna NNP 37 aev aev NNP 5 ae­gean ae­gean NNP 1 af af NNP 254 af af NN 12 afa afa NNP 39 afa afa NN 1 afac afac NN 1 afacility afacility NN 1 afaic afaic NNP 3 afaict afaict NNP 1 afaik afaik NNP 29 afaik afaik NN 2 afar afar NN 35 afar afar NNP 4 afarensis afarensis NNS 1 afatk afatk NNP 1 afb afb NNP 12 afc afc NNP 24 afca afca NNP 1 afcs afc NNP 1 afdc afdc NNP 28 afdc-unemployed afdc-unemployed NNP 1 afeared afeared JJ 6 afer afer NN 1 aferguson aferguson NNP 1 afew afew NNP 3 afewerki afewerkus NNP 1 aff aff NN 1 aff aff NNP 1 affability affability NN 4 affable affable JJ 19 affably affably RB 3 affair affair NN 629 affair affair NNP 49 affair affair UNC 4 affaire affaire NN 22 affaire affaire NNP 1 affaires affaire NNS 3 affairs affair NNS 401 affairs affair NNP 202 affairs affair NNPS 78 affairs affairs UNC 3 affairspartnership affairspartnership NN 1 affairsthe affairsthe NNP 1 affarisc affarisc NNP 1 affc affc NNP 1 affeared affeared JJ 1 affect affect VB 984 affect affect VBP 264 affect affect NN 87 affect affect NNP 23 affect affect UNC 1 affectation affectation NN 7 affectation affectation NNP 1 affectations affectation NNS 4 affected affect VBN 1169 affected affect VBD 152 affected affected JJ 22 affected affected NNP 19 affected affected UNC 1 affectedunits affectedunit NNS 1 affecting affect VBG 333 affecting affecting NNP 8 affectingly affectingly RB 1 affection affection NN 192 affection affection NNP 7 affectionat affectionat NN 1 affectionate affectionate JJ 51 affectionate affectionate NNP 2 affectionately affectionately RB 22 affectionately affectionately NNP 2 affections affection NNS 22 affections affection NNP 3 affective affective JJ 12 affectivity affectivity NN 1 affectless affectless JJ 8 affectless affectless UNC 1 affectlessness affectlessness NNS 3 affects affect VBZ 397 affects affects UNC 1 affects affects NN 1 affen affen NNP 1 afferent afferent NN 44 afferents afferent NNS 57 afferents afferent NNP 2 afffection afffection NN 1 affi affi NNP 2 affianced affianced JJ 1 affiche affiche NNP 1 afficionado afficionado NN 1 affictions affiction NNS 1 affidavit affidavit NN 99 affidavit affidavit UNC 2 affidavit affidavit NNP 1 affidavits affidavit NNS 15 affigel affigel NNP 6 affiliate affiliate NN 72 affiliate affiliate NNP 1 affiliated affiliate VBN 104 affiliated affiliated NNP 3 affiliated affiliated JJ 1 affiliateid affiliateid NN 1 affiliates affiliate NNS 44 affiliates affiliate NNP 1 affiliating affiliate VBG 1 affiliation affiliation NN 57 affiliation affiliation NNP 6 affiliations affiliation NNS 13 affine affine NN 1 affinities affinity NNS 61 affinities affinity NNP 1 affinity affinity NN 497 affinity affinity NNP 17 affinity-purification affinity-purification JJ 1 affinity-purified affinity-purified JJ 17 affinity-purified affinity-purified NNP 5 affirm affirm NN 35 affirm affirm NNP 4 affirmation affirmation NN 39 affirmation affirmation NNP 1 affirmations affirmation NNS 3 affirmative affirmative JJ 287 affirmative affirmative NNP 25 affirmative affirmative UNC 2 affirmative-action affirmative-action NN 20 affirmative-action-friendly affirmative-action-friendly JJ 1 affirmatively affirmatively RB 6 affirmed affirm VBD 39 affirmed affirmed NNP 4 affirmed affirmed UNC 1 affirming affirm VBG 28 affirming affirming NNP 1 affirms affirm NNS 12 affix affix NN 14 affix affix NNP 3 affixations affixation NNP 3 affixed affixed JJ 24 affixes affix NNS 5 affixing affix VBG 4 afflatus afflatus JJ 2 affleck affleck NNP 88 afflecks affleck NNP 2 afflerbach afflerbach NNP 3 affliate affliate NN 1 afflict afflict VB 17 afflicted afflict VBN 73 afflicted afflicted NNP 3 afflicting afflict VBG 15 affliction affliction NN 20 affliction affliction NNP 11 afflictions affliction NNS 9 afflicts afflict VBZ 18 afflicts afflict NNP 1 affluence affluence NN 20 affluent affluent JJ 107 affluent affluent NN 5 affluent affluent NNP 3 affluentials affluential NNS 1 affluents affluent NNS 1 affluenza affluenza NN 1 afford afford VB 878 afford afford VBP 37 afford afford NNP 4 affordability affordability NN 14 affordability affordability NNP 2 affordabilty affordabilty NN 1 affordable affordable JJ 164 affordable affordable NNP 6 affordable affordable UNC 1 affordably affordably RB 6 afforded afford VBN 74 affording afford VBG 24 affords afford NNS 51 affricate affricate NN 1 affront affront NN 38 affronted affronted JJ 2 affronts affront NNS 1 affusion affusion NN 2 affusions affusion NNS 1 affx affx NN 1 affx affx NNP 1 affy affy NNP 1 affymetirx affymetirx NNP 1 affymetnx affymetnx NNP 1 affymetrix affymetrix NNP 357 affymetrix affymetrix NN 8 affymetrx affymetrx NNP 1 afg afg NNP 3 afganistan afganistan NNP 2 afge afge NNP 2 afghan afghan JJ 212 afghan afghan NNP 36 afghan afghan NN 6 afghan-army afghan-army NNP 2 afghan-austin afghan-austin NNP 1 afghan-based afghan-based NNP 2 afghan-bomb afghan-bomb NNP 3 afghan-islam afghan-islam NNP 1 afghan-journal afghan-journal NNP 2 afghan-military afghan-military NNP 1 afghan-security afghan-security NNP 1 afghan-u afghan-u NNP 1 afghan-valley afghan-valley NNP 1 afghani afghanus NNP 13 afghani afghanus NN 1 afghania afghanium NNP 1 afghanis afghani NNP 3 afghanistan afghanistan NNP 899 afghanistan afghanistan NN 2 afghanistan afghanistan UNC 1 afghanistan-a afghanistan-a NNP 1 afghanistan-based afghanistan-based NNP 3 afghanistan-in afghanistan-in NNP 1 afghanistanis afghanistani NNP 1 afghans afghan NNPS 30 afghans afghan NNS 6 afghans afghan NNP 2 afghans-meet afghans-meet NNP 2 afgp afgp NNP 2 afi afi UNC 2 afi afus NNP 30 afia afium NNP 1 aficionado aficionado NN 10 aficionado aficionado UNC 1 aficionado aficionado NNP 1 aficionados aficionado NNS 40 aficionados aficionado NNP 2 afield afield RB 25 afif afif NNP 1 afilliate afilliate NN 1 afire afire RB 4 afire afire NNP 1 afits afit NNS 1 afix afix NN 1 afl afl NNP 8 afl-cio afl-cio NNP 75 afl-cio-organized afl-cio-organized NNP 1 afl-nfl afl-nfl NNP 1 aflac aflac NNP 2 aflame aflame NN 3 aflame aflame NNP 1 aflii aflius NNP 3 aflitos aflito NNP 3 afloat afloat RB 50 afloat afloat UNC 1 afloat afloat NNP 1 aflp aflp NNP 19 aflp-based aflp-based NNP 1 aflps aflp NNP 1 aflutter aflutter NN 3 afm afm NNP 2 afmb afmb NNP 1 afmd afmd NNP 1 afo afo NN 1 afonsin afonsin NNP 1 afonso afonso NNP 15 afoot afoot RB 32 afoot afoot NNP 3 afor afor NN 3 afor afor NNP 2 afore afore NN 2 afore-mentioned afore-mentioned JJ 1 aforementioned aforementioned JJ 87 aforementioned aforementioned NNP 1 aforesaid aforesaid NN 5 aforethought aforethought JJ 5 aform aform NN 1 afoul afoul NN 34 afp afp NNP 2 afquarterly afquarterly RB 1 afr afr NNP 1 afraid afraid JJ 889 afraid afraid NNP 24 afraid afraid UNC 4 aframomum aframomum NNP 5 afresh afresh NN 11 afri afri NNP 1 afri afrus NNP 2 afriad afriad NN 1 africa africa NNP 912 africa africa UNC 6 africa-wide africa-wide NNP 1 africa-with-intention-of-getting-soul africa-with-intention-of-getting-soul NNP 1 africaine africaine NNP 1 african african NNP 681 african african JJ 465 african african NN 2 african-american african-american JJ 2 african-artifacts african-artifact NNP 1 african-descended african-descended NNP 1 african-grown african-grown NNP 1 african-style african-style NNP 1 africana africana NNP 39 africanamericans africanamerican NNP 1 africanism africanism NNP 1 africanist africanist NNP 2 africanity africanity NNP 2 africanize africanize NNP 1 africanoodian africanoodian NNP 1 africans african NNPS 85 africans african NNS 1 africare africare NNP 1 africas africa NNP 1 africaworld africaworld NNP 1 afridi afridus NNP 1 afriend afriend NNP 2 afriend afriend NN 1 afrika afrika NNP 1 afrikaans afrikaan NNP 17 afrikan afrikan NNP 1 afrikaner afrikaner JJ 3 afrikaners afrikaner NNPS 2 afrikaners afrikaners UNC 1 afrikas afrika NNP 1 afriyachts afriyacht NNP 1 afro afro NNP 44 afro afro NN 3 afro-futurist afro-futurist NNP 1 afro-pop afro-pop NNP 2 afroamerican afroamerican NNP 1 afrocentric afrocentric NNP 7 afrocentrism afrocentrism NNP 3 afrocentrist afrocentrist NNP 1 afrocentrists afrocentrist NNP 3 afroed afroed NNP 1 afront afront NNP 1 afrophile afrophile NNP 2 afropick afropick NN 1 afros afro NNS 1 afs af NNP 2 afsa afsa NNP 3 afsc afsc NNP 1 afscme afscme NNP 1 afshin afshin NNP 1 afsluitdijk afsluitdijk NNP 2 aft aft JJ 10 aft aft NNP 5 aft aft NN 1 afta afta NN 1 afta afta NNP 1 after after IN 23925 after after NNP 76 after after UNC 57 after after RB 52 after after NN 3 after-action after-action JJ 5 after-after-party after-after-party JJ 1 after-birth after-birth JJ 1 after-care after-care JJ 1 after-college after-college JJ 1 after-dark after-dark JJ 4 after-days after-day JJ 1 after-death after-death JJ 1 after-dinner after-dinner JJ 10 after-effect after-effect JJ 1 after-effects after-effect JJ 2 after-hours after-hour JJ 21 after-life after-life JJ 2 after-market after-market JJ 2 after-movie after-movie JJ 1 after-office after-office JJ 1 after-party after-party JJ 1 after-purchase after-purchase JJ 6 after-sales after-sale JJ 3 after-school after-school JJ 21 after-school after-school NNP 1 after-shave after-shave JJ 1 after-tax after-tax JJ 12 after-tax after-tax NNP 1 after-the-fact after-the-fact JJ 3 after-the-rapture after-the-rapture JJ 1 after-wit after-wit JJ 1 after-work after-work JJ 4 afteraction afteraction NN 1 afteraffects afteraffect NNS 1 afterall afterall NN 3 afterall afterall NNP 2 afterbirth afterbirth NN 1 afterburn afterburn NN 1 afterburner afterburner NN 3 afterburners afterburner NNS 2 aftercare aftercare NN 1 aftercare-follow-up aftercare-follow-up JJ 1 afterday afterday NN 1 aftereffect aftereffect NN 2 aftereffects aftereffect NNS 6 afterewards aftereward NNS 1 afterglow afterglow NN 10 afterglow afterglow NNP 6 afterimage afterimage NN 2 afterlife afterlife NN 38 afterlife afterlife NNP 3 afterload afterload NN 4 aftermarket aftermarket NN 3 aftermarkof aftermarkof NN 1 aftermath aftermath NN 171 aftermath aftermath NNP 2 aftermath aftermath UNC 1 aftermaths aftermath NNS 1 afternoon afternoon NN 1064 afternoon afternoon NNP 23 afternoon afternoon UNC 3 afternoon-drive afternoon-drive JJ 1 afternoons afternoon NNS 72 afternoons afternoon NNP 3 afternovember afternovember NN 1 afteroon afteroon NN 1 afterparties afterparty NNS 1 afterplay afterplay NN 1 afters afters NNS 1 afterschool afterschool NN 4 afterschool afterschool NNP 1 aftershave aftershave NN 1 aftershock aftershock NN 5 aftershocks aftershock NNS 19 aftertaste aftertaste NN 13 aftertaste aftertaste UNC 1 aftertaste aftertaste NNP 1 aftertax aftertax JJ 2 afterthefact afterthefact NN 1 afterthought afterthought NN 23 afterthought afterthought NNP 1 afterthoughts afterthought NNS 2 afterthoughts afterthought NNP 2 afterward afterward RB 202 afterward afterward UNC 1 afterwards afterward RB 227 afterwards afterwards UNC 1 afterword afterword NN 5 afterword afterword NNP 3 afterwords afterword NNS 1 afterwork afterwork NN 1 afteryou afteryou NN 1 aftra aftra NNP 1 aftrer aftrer NN 1 aftyr aftyr NN 1 afu afu NNP 1 afu afu NN 1 afuer afuer NNP 1 afuera afuera NN 1 aful aful NNP 1 afunny afunny NNP 1 afw afw NNP 1 afx afx NNP 1 afyon afyon NNP 1 ag ag NNP 217 ag ag NN 3 ag-gt ag-gt NNP 1 ag-pandering ag-pandering JJ 1 ag-specific ag-specific NNP 1 ag-stuff ag-stuff JJ 1 aga aga NNP 48 aga aga NN 3 agaa agaa NNP 1 agaaattgccgttgcagtgac agaaattgccgttgcagtgac NNP 1 agaacagcaagtgct agaacagcaagtgct NNP 1 agaaggagcaggacaccagc agaaggagcaggacaccagc NNP 1 agac agac NNP 3 agacacaatcgactgaagg agacacaatcgactgaagg NNP 1 agacattgacttagctgtggat agacattgacttagctgtggat NN 1 agacgfm agacgfm NN 2 agacuugaggucggucaacguguac agacuugaggucggucaacguguac NNP 1 agaete agaete NNP 3 agaetis agaeti NNP 2 agaggaagacactgttgagtag agaggaagacactgttgagtag NNP 1 agaggtgctggtgccaac agaggtgctggtgccaac NNP 1 agahi agahus NNP 8 agahst agahst NN 1 again again RB 8138 again again UNC 49 again again NNP 48 again again JJ 8 again again NN 1 again-it again-it JJ 1 again-off again-off JJ 1 againand againand NN 1 againe againe NN 1 against against IN 9446 against against NNP 33 against against UNC 8 against-the-odds against-the-odd JJ 1 agaion agaion NN 1 agambiae agambia NN 1 agame agame NNP 1 agamemnon agamemnon NNP 14 agamenmon agamenmon NNP 1 agammaglobulinemia agammaglobulinemium NN 3 agammemnon agammemnon NNP 3 aganda aganda NN 1 aganist aganist NN 1 agapanthus agapanthus JJ 4 agape agape NN 11 agape agape NNP 2 agapemone agapemone NNP 1 agar agar NN 142 agar agar NNP 5 agarase agarase NN 1 agarcia agarcium NN 3 agaricus agaricus NNP 1 agarose agarose NN 220 agarose agarose NNP 10 agarose-cast agarose-cast NNP 1 agarose-coated agarose-coated JJ 1 agarose-formaldehyde agarose-formaldehyde JJ 3 agarose-gel agarose-gel JJ 1 agarrar agarrar NN 1 agarwal agarwal NNP 8 agarwals agarwal NNP 1 agas aga NNP 2 agassi agassus NNP 74 agassiz agassiz NNP 1 agastache agastache NNP 1 agat agat NNP 5 agatcc agatcc NNP 1 agatcccaggggtctgtgaaaatggagtgt agatcccaggggtctgtgaaaatggagtgt NNP 1 agatct agatct NNP 1 agatctgattctaaccatatcgagtgg agatctgattctaaccatatcgagtgg NNP 1 agate agate NN 6 agate-type agate-type NNP 1 agatep agatep NNP 1 agateware agateware NN 1 agatgcgggcacggctgttcaagga agatgcgggcacggctgttcaagga NNP 1 agatgctggccatcataggg agatgctggccatcataggg NNP 1 agatha agatha NNP 11 agathe-des agathe-des NNP 1 agathism agathism NN 1 agathistic agathistic JJ 1 agavachado agavachado NNP 1 agavachado agavachado NN 1 agave agave NN 7 agave agave NNP 1 agaves agave NNS 1 agawan agawan NNP 1 agayne agayne NN 1 agazine agazine NN 1 agbayani agbayanus NNP 2 agbout agbout NN 1 agc agc NNP 19 agc agc NN 2 agc-related agc-related NNP 1 agcactgtgttggcgtacag agcactgtgttggcgtacag NNP 1 agcagatgtaggtcctgcacttg agcagatgtaggtcctgcacttg NNP 1 agccac agccac NNP 1 agccagcagccggaaaactccagt agccagcagccggaaaactccagt NNP 2 agccatcaatgataggatcca agccatcaatgataggatcca NNP 1 agccccccagcgtaaagat agccccccagcgtaaagat NNP 1 agcccgtgcagccatcagcc agcccgtgcagccatcagcc NNP 2 agcctggatggctacgtaca agcctggatggctacgtaca NNP 1 agcn agcn NNP 3 agcop agcop NNP 2 agcp agcp NN 5 agct agct NNP 2 agctcagggagtacttcaaga agctcagggagtacttcaaga NN 1 agctcatcatgcagctcat agctcatcatgcagctcat NNP 1 agctctgcagcacaaactttaataaatccgaaac agctctgcagcacaaactttaataaatccgaaac NNP 1 agctg agctg NNP 1 agctgaattccacaaactttaataaatccgaaac agctgaattccacaaactttaataaatccgaaac NNP 1 agctgcggccgccctgaaccggttgggtgccac agctgcggccgccctgaaccggttgggtgccac NNP 2 agctggccctggcactgctctgctct agctggccctggcactgctctgctct NNP 1 agde agde NNP 6 age age NN 4624 age age NNP 503 age age VBP 46 age age UNC 11 age age JJ 2 age-adjusted age-adjusted JJ 33 age-adjusted age-adjusted NNP 2 age-appropriate age-appropriate JJ 6 age-appropriate age-appropriate NNP 1 age-associated age-associated JJ 3 age-at-onset age-at-onset JJ 2 age-based age-based JJ 6 age-blip age-blip JJ 1 age-bsa age-bsa NNP 27 age-bsa-induced age-bsa-induced NNP 1 age-conditional age-conditional JJ 8 age-darkened age-darkened JJ 1 age-dependent age-dependent JJ 5 age-discrimination age-discrimination JJ 1 age-eligible age-eligible JJ 2 age-emphasizing age-emphasizing JJ 1 age-gender-matched age-gender-matched JJ 1 age-group age-group JJ 3 age-groups age-group JJ 1 age-inappropriate age-inappropriate JJ 1 age-intensity age-intensity JJ 1 age-matched age-matched JJ 29 age-modified age-modified JJ 8 age-old age-old JJ 40 age-peers age-peer JJ 2 age-range age-range JJ 1 age-ravaged age-ravaged JJ 1 age-related age-related JJ 52 age-retardation age-retardation JJ 1 age-smoking age-smoking JJ 2 age-specific age-specific JJ 50 age-specific age-specific NNP 3 age-specificity age-specificity JJ 1 age-squared age-squared JJ 2 age-stratified age-stratified NNP 1 age-structured age-structured JJ 2 aged age VBN 389 aged aged NNP 6 aged aged JJ 1 aged aged UNC 1 aged-based aged-based JJ 1 aged-matched aged-matched JJ 3 agedly agedly RB 1 agee agee NNP 3 agei ageus NNP 3 agei-nhei agei-nheus NNP 1 ageing age VBG 26 ageing ageing UNC 2 ageing ageing NNP 1 ageing-can-be-regulated ageing-can-be-regulated JJ 1 ageism ageism NN 2 ageist ageist NN 7 ageless ageless JJ 9 ageless ageless NNP 1 agellon agellon NNP 3 agemates agemate NNS 13 agemates agemates UNC 1 agemilestone agemilestone NNP 1 agen agen NN 2 agenbite agenbite NN 1 agenbroad agenbroad NNP 1 agence agence NNP 10 agencies agencies UNC 10 agencies agencies NN 1 agencies agencies JJ 1 agencies agency NNS 2141 agencies agency NNPS 122 agencies agency NNP 9 agencies-and agencies-and JJ 1 agencies-away agencies-away JJ 1 agencies-missionary agencies-missionary JJ 1 agencies-the agencies-the JJ 1 agencies-unaccustomed agencies-unaccustomed JJ 1 agencies-while agencies-while JJ 1 agenciesacquisition agenciesacquisition NN 1 agenciesgsa agenciesgsa NN 1 agency agency NN 2507 agency agency NNP 549 agency agency UNC 1 agency-are agency-are JJ 1 agency-based agency-based JJ 2 agency-believed agency-believed JJ 1 agency-designated agency-designated JJ 8 agency-determined agency-determined JJ 1 agency-specific agency-specific JJ 5 agencydesignated agencydesignated JJ 3 agencyoffice agencyoffice NNP 2 agencyprotocols agencyprotocol NNP 2 agencyspecific agencyspecific JJ 2 agencyusers agencyuser NNS 1 agencywide agencywide NN 17 agend agend NN 1 agenda agenda NN 524 agenda agenda NNP 20 agenda agenda UNC 4 agenda agenda JJ 1 agenda-driven agenda-driven JJ 1 agenda-save agenda-save JJ 1 agenda-setting agenda-setting JJ 1 agendas agenda NNS 48 agendas agenda NNP 1 agendum agendum NN 2 agendum agendum NNP 1 agenerase agenerase NNP 1 ageneration ageneration NNP 1 agenes agene NNP 1 agenesis agenesis NNS 3 agenesis agenesis NNP 1 agenseeing agensee VBG 2 agent agent NN 1140 agent agent NNP 58 agent agent UNC 4 agent-based agent-based JJ 1 agent-noun agent-noun JJ 1 agent-provocateur agent-provocateur NNP 1 agent-speak agent-speak JJ 1 agent-y agent-y NNP 1 agentdom agentdom NN 1 agentries agentry NN